Incidental Mutation 'R2205:Ube3b'
ID 238963
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 040207-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2205 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114380607-114421169 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114389074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 118 (V118M)
Ref Sequence ENSEMBL: ENSMUSP00000138723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]
AlphaFold Q9ES34
Predicted Effect probably damaging
Transcript: ENSMUST00000074002
AA Change: V118M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: V118M

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130169
AA Change: V118M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: V118M

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151809
SMART Domains Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 5.6e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
5830473C10Rik A G 5: 90,569,562 T201A possibly damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca14 T C 7: 120,247,280 S652P probably damaging Het
Acsl6 G A 11: 54,324,007 G75S probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
Aknad1 A G 3: 108,757,293 D406G probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Arhgap35 A T 7: 16,498,025 probably null Het
Bag6 G A 17: 35,144,607 G751R probably damaging Het
Brat1 G A 5: 140,705,133 probably benign Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Catsperg1 G A 7: 29,185,246 Q922* probably null Het
Cfap221 T G 1: 119,936,104 Y570S possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cpd A G 11: 76,802,244 Y739H probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dhrs7 A T 12: 72,656,370 V188E probably damaging Het
Dpp9 A C 17: 56,199,287 I411S possibly damaging Het
Fitm2 G A 2: 163,472,596 probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpatch1 C A 7: 35,291,772 D616Y probably damaging Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Hoxb3 T A 11: 96,345,668 S191T probably benign Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Megf8 C T 7: 25,341,748 T1134I probably benign Het
Nipsnap1 C A 11: 4,889,974 H232N possibly damaging Het
Nme4 A T 17: 26,092,140 H150Q possibly damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
P2rx7 T A 5: 122,681,101 Y529N probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pofut1 T A 2: 153,261,247 M267K probably damaging Het
Rad54l2 T C 9: 106,717,798 D320G probably damaging Het
Rdm1 C A 11: 101,634,803 A225E probably damaging Het
Samm50 G A 15: 84,202,314 A245T probably benign Het
Scfd2 A T 5: 74,225,367 M597K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l2 T C 13: 112,898,890 I510V probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Tbc1d31 A G 15: 57,953,520 D717G probably benign Het
Tma7 C A 9: 109,082,226 probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Tns3 T C 11: 8,531,719 Y211C probably damaging Het
Ttc21b C T 2: 66,235,123 G436S possibly damaging Het
Ttn T C 2: 76,851,563 probably benign Het
Usp34 A G 11: 23,385,147 T1210A probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Wdr62 T A 7: 30,258,149 probably null Het
Ywhah A G 5: 33,027,140 N229S probably damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Zswim4 G T 8: 84,225,869 T488N possibly damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8058:Ube3b UTSW 5 114406785 missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114412489 critical splice donor site probably null
R8182:Ube3b UTSW 5 114392138 missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
R8682:Ube3b UTSW 5 114412290 missense probably damaging 1.00
R8708:Ube3b UTSW 5 114393090 missense probably benign 0.34
R8758:Ube3b UTSW 5 114415200 critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114388739 missense probably damaging 1.00
R9058:Ube3b UTSW 5 114415239 missense probably benign 0.05
R9072:Ube3b UTSW 5 114404546 missense probably damaging 0.98
R9116:Ube3b UTSW 5 114404776 intron probably benign
R9537:Ube3b UTSW 5 114387184 missense probably damaging 1.00
R9596:Ube3b UTSW 5 114389110 missense probably damaging 1.00
R9632:Ube3b UTSW 5 114415309 missense probably benign 0.00
R9710:Ube3b UTSW 5 114415309 missense probably benign 0.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGTTGGGTAGATGGACAACGC -3'
(R):5'- AGTCCTCTCCTGGCTAGTAGAC -3'

Sequencing Primer
(F):5'- AGATGGACAACGCCTCGTCTTC -3'
(R):5'- TGGCTAGTAGACCCCCGAAG -3'
Posted On 2014-10-02