Mutagenetix > Incidental Mutation

Incidental Mutation 'R2205:Ube3b'

238963

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

040207-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2205 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114389074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 118 (V118M)

Ref Sequence

ENSEMBL: ENSMUSP00000138723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]

AlphaFold

Q9ES34

Predicted Effect

probably damaging
Transcript: ENSMUST00000074002
AA Change: V118M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: V118M

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130169
AA Change: V118M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: V118M

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151809

SMART Domains

Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	5.6e-5	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
5830473C10Rik	A	G	5: 90,569,562	T201A	possibly damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca14	T	C	7: 120,247,280	S652P	probably damaging	Het
Acsl6	G	A	11: 54,324,007	G75S	probably damaging	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
Aknad1	A	G	3: 108,757,293	D406G	probably damaging	Het
Ankrd2	C	A	19: 42,044,119	A273E	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Arhgap35	A	T	7: 16,498,025		probably null	Het
Bag6	G	A	17: 35,144,607	G751R	probably damaging	Het
Brat1	G	A	5: 140,705,133		probably benign	Het
Cacna1h	C	T	17: 25,380,260	A1742T	probably damaging	Het
Catsperg1	G	A	7: 29,185,246	Q922*	probably null	Het
Cfap221	T	G	1: 119,936,104	Y570S	possibly damaging	Het
Cfap45	T	C	1: 172,532,161	V76A	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cpd	A	G	11: 76,802,244	Y739H	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dhrs7	A	T	12: 72,656,370	V188E	probably damaging	Het
Dpp9	A	C	17: 56,199,287	I411S	possibly damaging	Het
Fitm2	G	A	2: 163,472,596		probably benign	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpatch1	C	A	7: 35,291,772	D616Y	probably damaging	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Hoxb3	T	A	11: 96,345,668	S191T	probably benign	Het
Ifit1bl1	C	T	19: 34,594,341	E239K	probably benign	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Megf8	C	T	7: 25,341,748	T1134I	probably benign	Het
Nipsnap1	C	A	11: 4,889,974	H232N	possibly damaging	Het
Nme4	A	T	17: 26,092,140	H150Q	possibly damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
P2rx7	T	A	5: 122,681,101	Y529N	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pofut1	T	A	2: 153,261,247	M267K	probably damaging	Het
Rad54l2	T	C	9: 106,717,798	D320G	probably damaging	Het
Rdm1	C	A	11: 101,634,803	A225E	probably damaging	Het
Samm50	G	A	15: 84,202,314	A245T	probably benign	Het
Scfd2	A	T	5: 74,225,367	M597K	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skiv2l2	T	C	13: 112,898,890	I510V	probably benign	Het
Ssh3	A	G	19: 4,269,073	L3P	probably damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Tbc1d31	A	G	15: 57,953,520	D717G	probably benign	Het
Tma7	C	A	9: 109,082,226		probably benign	Het
Tmc1	A	T	19: 20,940,905	L2M	probably benign	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Tns3	T	C	11: 8,531,719	Y211C	probably damaging	Het
Ttc21b	C	T	2: 66,235,123	G436S	possibly damaging	Het
Ttn	T	C	2: 76,851,563		probably benign	Het
Usp34	A	G	11: 23,385,147	T1210A	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r104	A	T	17: 20,029,821	N729K	probably benign	Het
Wdr62	T	A	7: 30,258,149		probably null	Het
Ywhah	A	G	5: 33,027,140	N229S	probably damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,183,446	A139D	probably damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het
Zswim4	G	T	8: 84,225,869	T488N	possibly damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- TGTTGGGTAGATGGACAACGC -3'
(R):5'- AGTCCTCTCCTGGCTAGTAGAC -3'

Sequencing Primer
(F):5'- AGATGGACAACGCCTCGTCTTC -3'
(R):5'- TGGCTAGTAGACCCCCGAAG -3'

Posted On

2014-10-02