Incidental Mutation 'R2205:P2rx7'
ID238965
Institutional Source Beutler Lab
Gene Symbol P2rx7
Ensembl Gene ENSMUSG00000029468
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 7
SynonymsP2X7R, P2X7 receptor, P2X(7)
MMRRC Submission 040207-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2205 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122643911-122691432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122681101 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 529 (Y529N)
Ref Sequence ENSEMBL: ENSMUSP00000098303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]
Predicted Effect probably benign
Transcript: ENSMUST00000031425
SMART Domains Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 1e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100737
AA Change: Y529N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: Y529N

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 397 3.6e-158 PFAM
low complexity region 435 451 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121489
SMART Domains Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 3.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199371
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
5830473C10Rik A G 5: 90,569,562 T201A possibly damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca14 T C 7: 120,247,280 S652P probably damaging Het
Acsl6 G A 11: 54,324,007 G75S probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
Aknad1 A G 3: 108,757,293 D406G probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Arhgap35 A T 7: 16,498,025 probably null Het
Bag6 G A 17: 35,144,607 G751R probably damaging Het
Brat1 G A 5: 140,705,133 probably benign Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Catsperg1 G A 7: 29,185,246 Q922* probably null Het
Cfap221 T G 1: 119,936,104 Y570S possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cpd A G 11: 76,802,244 Y739H probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dhrs7 A T 12: 72,656,370 V188E probably damaging Het
Dpp9 A C 17: 56,199,287 I411S possibly damaging Het
Fitm2 G A 2: 163,472,596 probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpatch1 C A 7: 35,291,772 D616Y probably damaging Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Hoxb3 T A 11: 96,345,668 S191T probably benign Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Megf8 C T 7: 25,341,748 T1134I probably benign Het
Nipsnap1 C A 11: 4,889,974 H232N possibly damaging Het
Nme4 A T 17: 26,092,140 H150Q possibly damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pofut1 T A 2: 153,261,247 M267K probably damaging Het
Rad54l2 T C 9: 106,717,798 D320G probably damaging Het
Rdm1 C A 11: 101,634,803 A225E probably damaging Het
Samm50 G A 15: 84,202,314 A245T probably benign Het
Scfd2 A T 5: 74,225,367 M597K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l2 T C 13: 112,898,890 I510V probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Tbc1d31 A G 15: 57,953,520 D717G probably benign Het
Tma7 C A 9: 109,082,226 probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Tns3 T C 11: 8,531,719 Y211C probably damaging Het
Ttc21b C T 2: 66,235,123 G436S possibly damaging Het
Ttn T C 2: 76,851,563 probably benign Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Usp34 A G 11: 23,385,147 T1210A probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Wdr62 T A 7: 30,258,149 probably null Het
Ywhah A G 5: 33,027,140 N229S probably damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Zswim4 G T 8: 84,225,869 T488N possibly damaging Het
Other mutations in P2rx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:P2rx7 APN 5 122676698 missense probably damaging 1.00
IGL01911:P2rx7 APN 5 122658768 missense probably damaging 0.99
IGL02375:P2rx7 APN 5 122673656 splice site probably benign
IGL02502:P2rx7 APN 5 122680987 missense possibly damaging 0.92
IGL03102:P2rx7 APN 5 122663605 missense possibly damaging 0.88
IGL03179:P2rx7 APN 5 122673700 missense possibly damaging 0.66
ailing UTSW 5 122673736 missense probably benign
Enfermo UTSW 5 122652789 missense probably damaging 0.98
Incapacitated UTSW 5 122673793 missense probably damaging 0.99
Sickpuppy UTSW 5 122681003 missense probably damaging 0.96
PIT1430001:P2rx7 UTSW 5 122681216 missense probably damaging 0.99
R0363:P2rx7 UTSW 5 122657030 nonsense probably null
R0558:P2rx7 UTSW 5 122673798 missense possibly damaging 0.83
R1186:P2rx7 UTSW 5 122670451 missense probably damaging 1.00
R1709:P2rx7 UTSW 5 122670465 missense possibly damaging 0.95
R1856:P2rx7 UTSW 5 122681032 missense probably damaging 1.00
R1899:P2rx7 UTSW 5 122673736 missense probably benign
R1905:P2rx7 UTSW 5 122680952 missense probably damaging 1.00
R2082:P2rx7 UTSW 5 122644095 missense possibly damaging 0.92
R2117:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R2446:P2rx7 UTSW 5 122680816 missense probably benign
R3151:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R4052:P2rx7 UTSW 5 122666277 missense probably damaging 1.00
R4883:P2rx7 UTSW 5 122681066 missense probably damaging 1.00
R4930:P2rx7 UTSW 5 122670479 missense probably damaging 1.00
R5194:P2rx7 UTSW 5 122673795 missense probably benign 0.00
R5257:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5258:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5481:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R5656:P2rx7 UTSW 5 122673717 missense probably damaging 0.99
R5738:P2rx7 UTSW 5 122652789 missense probably damaging 0.98
R6587:P2rx7 UTSW 5 122664550 missense probably damaging 1.00
R7098:P2rx7 UTSW 5 122673793 missense probably damaging 0.99
R7120:P2rx7 UTSW 5 122681294 missense probably benign
R7180:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R7358:P2rx7 UTSW 5 122666142 critical splice acceptor site probably null
R7724:P2rx7 UTSW 5 122673373 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCAGCTGCTCCATGAAGAGG -3'
(R):5'- CTTGAAGCCACTATACTGCCC -3'

Sequencing Primer
(F):5'- CATGAAGAGGTGGCCCCTAAGTC -3'
(R):5'- CCTCGGTCTTGGGGAACTC -3'
Posted On2014-10-02