Mutagenetix > Incidental Mutation

Incidental Mutation 'R2205:P2rx7'

238965

Institutional Source

Beutler Lab

Gene Symbol

P2rx7

Ensembl Gene

ENSMUSG00000029468

Gene Name

purinergic receptor P2X, ligand-gated ion channel, 7

Synonyms

P2X7R, P2X7 receptor, P2X(7)

MMRRC Submission

040207-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2205 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122643911-122691432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 122681101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 529 (Y529N)

Ref Sequence

ENSEMBL: ENSMUSP00000098303 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]

AlphaFold

Q9Z1M0

Predicted Effect

probably benign
Transcript: ENSMUST00000031425

SMART Domains

Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	1e-149	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000100737
AA Change: Y529N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: Y529N

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	397	3.6e-158	PFAM
low complexity region	435	451	N/A	INTRINSIC
low complexity region	516	536	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121489

SMART Domains

Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	3.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197102

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199371

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
5830473C10Rik	A	G	5: 90,569,562	T201A	possibly damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca14	T	C	7: 120,247,280	S652P	probably damaging	Het
Acsl6	G	A	11: 54,324,007	G75S	probably damaging	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
Aknad1	A	G	3: 108,757,293	D406G	probably damaging	Het
Ankrd2	C	A	19: 42,044,119	A273E	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Arhgap35	A	T	7: 16,498,025		probably null	Het
Bag6	G	A	17: 35,144,607	G751R	probably damaging	Het
Brat1	G	A	5: 140,705,133		probably benign	Het
Cacna1h	C	T	17: 25,380,260	A1742T	probably damaging	Het
Catsperg1	G	A	7: 29,185,246	Q922*	probably null	Het
Cfap221	T	G	1: 119,936,104	Y570S	possibly damaging	Het
Cfap45	T	C	1: 172,532,161	V76A	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cpd	A	G	11: 76,802,244	Y739H	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dhrs7	A	T	12: 72,656,370	V188E	probably damaging	Het
Dpp9	A	C	17: 56,199,287	I411S	possibly damaging	Het
Fitm2	G	A	2: 163,472,596		probably benign	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpatch1	C	A	7: 35,291,772	D616Y	probably damaging	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Hoxb3	T	A	11: 96,345,668	S191T	probably benign	Het
Ifit1bl1	C	T	19: 34,594,341	E239K	probably benign	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Megf8	C	T	7: 25,341,748	T1134I	probably benign	Het
Nipsnap1	C	A	11: 4,889,974	H232N	possibly damaging	Het
Nme4	A	T	17: 26,092,140	H150Q	possibly damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pofut1	T	A	2: 153,261,247	M267K	probably damaging	Het
Rad54l2	T	C	9: 106,717,798	D320G	probably damaging	Het
Rdm1	C	A	11: 101,634,803	A225E	probably damaging	Het
Samm50	G	A	15: 84,202,314	A245T	probably benign	Het
Scfd2	A	T	5: 74,225,367	M597K	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skiv2l2	T	C	13: 112,898,890	I510V	probably benign	Het
Ssh3	A	G	19: 4,269,073	L3P	probably damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Tbc1d31	A	G	15: 57,953,520	D717G	probably benign	Het
Tma7	C	A	9: 109,082,226		probably benign	Het
Tmc1	A	T	19: 20,940,905	L2M	probably benign	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Tns3	T	C	11: 8,531,719	Y211C	probably damaging	Het
Ttc21b	C	T	2: 66,235,123	G436S	possibly damaging	Het
Ttn	T	C	2: 76,851,563		probably benign	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Usp34	A	G	11: 23,385,147	T1210A	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r104	A	T	17: 20,029,821	N729K	probably benign	Het
Wdr62	T	A	7: 30,258,149		probably null	Het
Ywhah	A	G	5: 33,027,140	N229S	probably damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,183,446	A139D	probably damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het
Zswim4	G	T	8: 84,225,869	T488N	possibly damaging	Het

Other mutations in P2rx7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:P2rx7	APN	5	122676698	missense	probably damaging	1.00
IGL01911:P2rx7	APN	5	122658768	missense	probably damaging	0.99
IGL02375:P2rx7	APN	5	122673656	splice site	probably benign
IGL02502:P2rx7	APN	5	122680987	missense	possibly damaging	0.92
IGL03102:P2rx7	APN	5	122663605	missense	possibly damaging	0.88
IGL03179:P2rx7	APN	5	122673700	missense	possibly damaging	0.66
ailing	UTSW	5	122673736	missense	probably benign
Enfermo	UTSW	5	122652789	missense	probably damaging	0.98
Incapacitated	UTSW	5	122673793	missense	probably damaging	0.99
Sickpuppy	UTSW	5	122681003	missense	probably damaging	0.96
Stumped	UTSW	5	122652726	critical splice acceptor site	probably null
BB009:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
BB019:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
PIT1430001:P2rx7	UTSW	5	122681216	missense	probably damaging	0.99
R0363:P2rx7	UTSW	5	122657030	nonsense	probably null
R0558:P2rx7	UTSW	5	122673798	missense	possibly damaging	0.83
R1186:P2rx7	UTSW	5	122670451	missense	probably damaging	1.00
R1709:P2rx7	UTSW	5	122670465	missense	possibly damaging	0.95
R1856:P2rx7	UTSW	5	122681032	missense	probably damaging	1.00
R1899:P2rx7	UTSW	5	122673736	missense	probably benign
R1905:P2rx7	UTSW	5	122680952	missense	probably damaging	1.00
R2082:P2rx7	UTSW	5	122644095	missense	possibly damaging	0.92
R2117:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R2446:P2rx7	UTSW	5	122680816	missense	probably benign
R3151:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R4052:P2rx7	UTSW	5	122666277	missense	probably damaging	1.00
R4883:P2rx7	UTSW	5	122681066	missense	probably damaging	1.00
R4930:P2rx7	UTSW	5	122670479	missense	probably damaging	1.00
R5194:P2rx7	UTSW	5	122673795	missense	probably benign	0.00
R5257:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5258:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5481:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R5656:P2rx7	UTSW	5	122673717	missense	probably damaging	0.99
R5738:P2rx7	UTSW	5	122652789	missense	probably damaging	0.98
R6587:P2rx7	UTSW	5	122664550	missense	probably damaging	1.00
R7098:P2rx7	UTSW	5	122673793	missense	probably damaging	0.99
R7120:P2rx7	UTSW	5	122681294	missense	probably benign
R7180:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R7358:P2rx7	UTSW	5	122666142	critical splice acceptor site	probably null
R7724:P2rx7	UTSW	5	122673373	missense	probably benign	0.07
R7932:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
R8240:P2rx7	UTSW	5	122655033	missense	probably damaging	1.00
R8425:P2rx7	UTSW	5	122670458	missense	probably damaging	0.96
R9140:P2rx7	UTSW	5	122652726	critical splice acceptor site	probably null
R9331:P2rx7	UTSW	5	122680898	missense	probably benign	0.01
Z1177:P2rx7	UTSW	5	122663641	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCTGCTCCATGAAGAGG -3'
(R):5'- CTTGAAGCCACTATACTGCCC -3'

Sequencing Primer
(F):5'- CATGAAGAGGTGGCCCCTAAGTC -3'
(R):5'- CCTCGGTCTTGGGGAACTC -3'

Posted On

2014-10-02