Incidental Mutation 'R2205:Nipsnap1'
ID238988
Institutional Source Beutler Lab
Gene Symbol Nipsnap1
Ensembl Gene ENSMUSG00000034285
Gene Namenipsnap homolog 1
Synonyms
MMRRC Submission 040207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R2205 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location4873951-4894200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4889974 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 232 (H232N)
Ref Sequence ENSEMBL: ENSMUSP00000049338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038570] [ENSMUST00000136552] [ENSMUST00000139737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038570
AA Change: H232N

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049338
Gene: ENSMUSG00000034285
AA Change: H232N

DomainStartEndE-ValueType
Pfam:NIPSNAP 185 282 2.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136552
Predicted Effect probably benign
Transcript: ENSMUST00000139737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183479
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. A similar protein in mice inhibits the calcium channel TRPV6, and is also localized to the inner mitochondrial membrane where it may play a role in mitochondrial DNA maintenance. A pseudogene of this gene is located on the short arm of chromosome 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele treated with nocistatin fail to exhibit suppression of neuropeptide nociceptin/orphanin FQ-induced tactile allodynia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
5830473C10Rik A G 5: 90,569,562 T201A possibly damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca14 T C 7: 120,247,280 S652P probably damaging Het
Acsl6 G A 11: 54,324,007 G75S probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
Aknad1 A G 3: 108,757,293 D406G probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Arhgap35 A T 7: 16,498,025 probably null Het
Bag6 G A 17: 35,144,607 G751R probably damaging Het
Brat1 G A 5: 140,705,133 probably benign Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Catsperg1 G A 7: 29,185,246 Q922* probably null Het
Cfap221 T G 1: 119,936,104 Y570S possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cpd A G 11: 76,802,244 Y739H probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dhrs7 A T 12: 72,656,370 V188E probably damaging Het
Dpp9 A C 17: 56,199,287 I411S possibly damaging Het
Fitm2 G A 2: 163,472,596 probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpatch1 C A 7: 35,291,772 D616Y probably damaging Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Hoxb3 T A 11: 96,345,668 S191T probably benign Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Megf8 C T 7: 25,341,748 T1134I probably benign Het
Nme4 A T 17: 26,092,140 H150Q possibly damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
P2rx7 T A 5: 122,681,101 Y529N probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pofut1 T A 2: 153,261,247 M267K probably damaging Het
Rad54l2 T C 9: 106,717,798 D320G probably damaging Het
Rdm1 C A 11: 101,634,803 A225E probably damaging Het
Samm50 G A 15: 84,202,314 A245T probably benign Het
Scfd2 A T 5: 74,225,367 M597K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l2 T C 13: 112,898,890 I510V probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Tbc1d31 A G 15: 57,953,520 D717G probably benign Het
Tma7 C A 9: 109,082,226 probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Tns3 T C 11: 8,531,719 Y211C probably damaging Het
Ttc21b C T 2: 66,235,123 G436S possibly damaging Het
Ttn T C 2: 76,851,563 probably benign Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Usp34 A G 11: 23,385,147 T1210A probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Wdr62 T A 7: 30,258,149 probably null Het
Ywhah A G 5: 33,027,140 N229S probably damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Zswim4 G T 8: 84,225,869 T488N possibly damaging Het
Other mutations in Nipsnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Nipsnap1 APN 11 4889098 missense possibly damaging 0.77
IGL01552:Nipsnap1 APN 11 4889124 missense probably damaging 1.00
IGL01744:Nipsnap1 APN 11 4889912 missense probably damaging 1.00
IGL01938:Nipsnap1 APN 11 4893134 missense probably benign 0.00
IGL03328:Nipsnap1 APN 11 4884096 missense possibly damaging 0.89
R0355:Nipsnap1 UTSW 11 4889957 missense probably damaging 1.00
R1126:Nipsnap1 UTSW 11 4884081 missense probably benign 0.01
R1815:Nipsnap1 UTSW 11 4889101 missense probably damaging 1.00
R2129:Nipsnap1 UTSW 11 4888932 missense probably benign 0.04
R4852:Nipsnap1 UTSW 11 4891468 nonsense probably null
R5776:Nipsnap1 UTSW 11 4888919 missense probably benign 0.00
R6073:Nipsnap1 UTSW 11 4888895 missense possibly damaging 0.86
R7122:Nipsnap1 UTSW 11 4883366 critical splice acceptor site probably null
R7263:Nipsnap1 UTSW 11 4882960 unclassified probably benign
R7538:Nipsnap1 UTSW 11 4884089 missense probably damaging 1.00
R7947:Nipsnap1 UTSW 11 4889145 missense possibly damaging 0.64
R8166:Nipsnap1 UTSW 11 4884057 missense probably benign 0.00
X0011:Nipsnap1 UTSW 11 4874069 missense probably benign
Z1177:Nipsnap1 UTSW 11 4889956 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGTTCATTCCCTTGGCCC -3'
(R):5'- GAATGATCTTGCCTACTCAAGC -3'

Sequencing Primer
(F):5'- TGGCCCCACTTTGGACC -3'
(R):5'- AAAAAGTGCTTGTTGTCTCCC -3'
Posted On2014-10-02