Incidental Mutation 'R2205:Tns3'
ID238989
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
MMRRC Submission 040207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R2205 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8531719 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 211 (Y211C)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect probably damaging
Transcript: ENSMUST00000020695
AA Change: Y211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: Y211C

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
5830473C10Rik A G 5: 90,569,562 T201A possibly damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca14 T C 7: 120,247,280 S652P probably damaging Het
Acsl6 G A 11: 54,324,007 G75S probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
Aknad1 A G 3: 108,757,293 D406G probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Arhgap35 A T 7: 16,498,025 probably null Het
Bag6 G A 17: 35,144,607 G751R probably damaging Het
Brat1 G A 5: 140,705,133 probably benign Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Catsperg1 G A 7: 29,185,246 Q922* probably null Het
Cfap221 T G 1: 119,936,104 Y570S possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cpd A G 11: 76,802,244 Y739H probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dhrs7 A T 12: 72,656,370 V188E probably damaging Het
Dpp9 A C 17: 56,199,287 I411S possibly damaging Het
Fitm2 G A 2: 163,472,596 probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpatch1 C A 7: 35,291,772 D616Y probably damaging Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Hoxb3 T A 11: 96,345,668 S191T probably benign Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Megf8 C T 7: 25,341,748 T1134I probably benign Het
Nipsnap1 C A 11: 4,889,974 H232N possibly damaging Het
Nme4 A T 17: 26,092,140 H150Q possibly damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
P2rx7 T A 5: 122,681,101 Y529N probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pofut1 T A 2: 153,261,247 M267K probably damaging Het
Rad54l2 T C 9: 106,717,798 D320G probably damaging Het
Rdm1 C A 11: 101,634,803 A225E probably damaging Het
Samm50 G A 15: 84,202,314 A245T probably benign Het
Scfd2 A T 5: 74,225,367 M597K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l2 T C 13: 112,898,890 I510V probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Tbc1d31 A G 15: 57,953,520 D717G probably benign Het
Tma7 C A 9: 109,082,226 probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Ttc21b C T 2: 66,235,123 G436S possibly damaging Het
Ttn T C 2: 76,851,563 probably benign Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Usp34 A G 11: 23,385,147 T1210A probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Wdr62 T A 7: 30,258,149 probably null Het
Ywhah A G 5: 33,027,140 N229S probably damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Zswim4 G T 8: 84,225,869 T488N possibly damaging Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8492701 missense probably benign 0.01
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
R8518:Tns3 UTSW 11 8492971 missense probably damaging 0.96
R8523:Tns3 UTSW 11 8448779 missense probably damaging 1.00
R8790:Tns3 UTSW 11 8518273 missense probably damaging 0.99
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACAGTAATGGTGCCCCTC -3'
(R):5'- ACAGGTTGTCTTTAACTCCCTG -3'

Sequencing Primer
(F):5'- ACTGTTCAGCACCCATTGGAG -3'
(R):5'- AACTCCCTGCCCCCATGG -3'
Posted On2014-10-02