Mutagenetix > Incidental Mutation

Incidental Mutation 'R2205:Cpd'

238994

Institutional Source

Beutler Lab

Gene Symbol

Cpd

Ensembl Gene

ENSMUSG00000020841

Gene Name

carboxypeptidase D

Synonyms

D830034L15Rik

MMRRC Submission

040207-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R2205 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76778424-76847018 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76802244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 739 (Y739H)

Ref Sequence

ENSEMBL: ENSMUSP00000021201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021201]

AlphaFold

O89001

Predicted Effect

probably damaging
Transcript: ENSMUST00000021201
AA Change: Y739H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: Y739H

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Zn_pept	62	471	1.71e-52	SMART
Zn_pept	502	900	2.11e-66	SMART
Zn_pept	930	1195	1.11e-42	SMART
Pfam:CarboxypepD_reg	1211	1284	3.6e-10	PFAM
transmembrane domain	1297	1319	N/A	INTRINSIC
low complexity region	1363	1371	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132796

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
5830473C10Rik	A	G	5: 90,569,562	T201A	possibly damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca14	T	C	7: 120,247,280	S652P	probably damaging	Het
Acsl6	G	A	11: 54,324,007	G75S	probably damaging	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
Aknad1	A	G	3: 108,757,293	D406G	probably damaging	Het
Ankrd2	C	A	19: 42,044,119	A273E	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Arhgap35	A	T	7: 16,498,025		probably null	Het
Bag6	G	A	17: 35,144,607	G751R	probably damaging	Het
Brat1	G	A	5: 140,705,133		probably benign	Het
Cacna1h	C	T	17: 25,380,260	A1742T	probably damaging	Het
Catsperg1	G	A	7: 29,185,246	Q922*	probably null	Het
Cfap221	T	G	1: 119,936,104	Y570S	possibly damaging	Het
Cfap45	T	C	1: 172,532,161	V76A	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dhrs7	A	T	12: 72,656,370	V188E	probably damaging	Het
Dpp9	A	C	17: 56,199,287	I411S	possibly damaging	Het
Fitm2	G	A	2: 163,472,596		probably benign	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpatch1	C	A	7: 35,291,772	D616Y	probably damaging	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Hoxb3	T	A	11: 96,345,668	S191T	probably benign	Het
Ifit1bl1	C	T	19: 34,594,341	E239K	probably benign	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Megf8	C	T	7: 25,341,748	T1134I	probably benign	Het
Nipsnap1	C	A	11: 4,889,974	H232N	possibly damaging	Het
Nme4	A	T	17: 26,092,140	H150Q	possibly damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
P2rx7	T	A	5: 122,681,101	Y529N	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pofut1	T	A	2: 153,261,247	M267K	probably damaging	Het
Rad54l2	T	C	9: 106,717,798	D320G	probably damaging	Het
Rdm1	C	A	11: 101,634,803	A225E	probably damaging	Het
Samm50	G	A	15: 84,202,314	A245T	probably benign	Het
Scfd2	A	T	5: 74,225,367	M597K	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skiv2l2	T	C	13: 112,898,890	I510V	probably benign	Het
Ssh3	A	G	19: 4,269,073	L3P	probably damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Tbc1d31	A	G	15: 57,953,520	D717G	probably benign	Het
Tma7	C	A	9: 109,082,226		probably benign	Het
Tmc1	A	T	19: 20,940,905	L2M	probably benign	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Tns3	T	C	11: 8,531,719	Y211C	probably damaging	Het
Ttc21b	C	T	2: 66,235,123	G436S	possibly damaging	Het
Ttn	T	C	2: 76,851,563		probably benign	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Usp34	A	G	11: 23,385,147	T1210A	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r104	A	T	17: 20,029,821	N729K	probably benign	Het
Wdr62	T	A	7: 30,258,149		probably null	Het
Ywhah	A	G	5: 33,027,140	N229S	probably damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,183,446	A139D	probably damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het
Zswim4	G	T	8: 84,225,869	T488N	possibly damaging	Het

Other mutations in Cpd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Cpd	APN	11	76797789	missense	probably benign	0.00
IGL00698:Cpd	APN	11	76840444	missense	possibly damaging	0.82
IGL01025:Cpd	APN	11	76795613	missense	probably damaging	1.00
IGL01292:Cpd	APN	11	76846245	missense	possibly damaging	0.80
IGL01571:Cpd	APN	11	76782296	missense	probably damaging	1.00
IGL01606:Cpd	APN	11	76812640	missense	probably benign
IGL02283:Cpd	APN	11	76840425	missense	probably benign	0.19
IGL02895:Cpd	APN	11	76785203	missense	probably benign	0.06
IGL02965:Cpd	APN	11	76790988	splice site	probably benign
IGL03116:Cpd	APN	11	76811713	missense	probably damaging	1.00
IGL03178:Cpd	APN	11	76806051	missense	probably benign	0.02
PIT4280001:Cpd	UTSW	11	76791024	missense	probably benign	0.23
PIT4382001:Cpd	UTSW	11	76797788	missense	probably benign
R0050:Cpd	UTSW	11	76792859	missense	possibly damaging	0.94
R0054:Cpd	UTSW	11	76790838	missense	probably damaging	1.00
R0054:Cpd	UTSW	11	76790838	missense	probably damaging	1.00
R0320:Cpd	UTSW	11	76840447	missense	possibly damaging	0.50
R0416:Cpd	UTSW	11	76785204	missense	probably benign	0.13
R0556:Cpd	UTSW	11	76802345	splice site	probably benign
R0666:Cpd	UTSW	11	76782327	missense	probably damaging	1.00
R0668:Cpd	UTSW	11	76784398	missense	probably damaging	1.00
R1180:Cpd	UTSW	11	76801753	missense	possibly damaging	0.56
R1472:Cpd	UTSW	11	76784398	missense	probably damaging	0.98
R1518:Cpd	UTSW	11	76840386	critical splice donor site	probably null
R1617:Cpd	UTSW	11	76846669	missense	probably damaging	1.00
R1786:Cpd	UTSW	11	76792798	missense	probably benign	0.00
R1854:Cpd	UTSW	11	76786338	missense	probably damaging	1.00
R1861:Cpd	UTSW	11	76784382	splice site	probably benign
R2159:Cpd	UTSW	11	76797641	missense	probably damaging	0.96
R2281:Cpd	UTSW	11	76797801	missense	probably benign	0.00
R2680:Cpd	UTSW	11	76790999	missense	probably benign
R2928:Cpd	UTSW	11	76846374	missense	probably benign
R2937:Cpd	UTSW	11	76811859	missense	probably damaging	1.00
R4133:Cpd	UTSW	11	76814818	nonsense	probably null
R4241:Cpd	UTSW	11	76846785	missense	probably benign	0.03
R4369:Cpd	UTSW	11	76797711	missense	possibly damaging	0.82
R4538:Cpd	UTSW	11	76790999	missense	probably benign
R4551:Cpd	UTSW	11	76811886	missense	probably damaging	1.00
R4617:Cpd	UTSW	11	76840615	missense	probably damaging	1.00
R4732:Cpd	UTSW	11	76811794	missense	probably damaging	0.99
R4733:Cpd	UTSW	11	76811794	missense	probably damaging	0.99
R4821:Cpd	UTSW	11	76846237	missense	probably benign	0.38
R4852:Cpd	UTSW	11	76785150	missense	probably benign	0.32
R4901:Cpd	UTSW	11	76790881	missense	probably damaging	1.00
R4988:Cpd	UTSW	11	76814830	missense	probably damaging	0.98
R4999:Cpd	UTSW	11	76846222	critical splice donor site	probably null
R5005:Cpd	UTSW	11	76813570	missense	probably damaging	1.00
R5092:Cpd	UTSW	11	76811704	missense	possibly damaging	0.75
R5438:Cpd	UTSW	11	76791966	missense	possibly damaging	0.65
R5524:Cpd	UTSW	11	76797901	nonsense	probably null
R5677:Cpd	UTSW	11	76799825	missense	probably benign
R5826:Cpd	UTSW	11	76784416	nonsense	probably null
R6031:Cpd	UTSW	11	76790888	missense	probably benign	0.00
R6031:Cpd	UTSW	11	76790888	missense	probably benign	0.00
R6103:Cpd	UTSW	11	76799799	missense	probably benign	0.00
R6257:Cpd	UTSW	11	76812670	missense	probably benign	0.37
R6263:Cpd	UTSW	11	76846271	missense	probably benign	0.00
R6485:Cpd	UTSW	11	76808707	splice site	probably null
R6671:Cpd	UTSW	11	76795533	missense	probably damaging	1.00
R6995:Cpd	UTSW	11	76785055	missense	probably benign	0.02
R7074:Cpd	UTSW	11	76813594	missense	probably damaging	1.00
R7192:Cpd	UTSW	11	76814841	missense	probably damaging	1.00
R7341:Cpd	UTSW	11	76846953	missense	unknown
R7371:Cpd	UTSW	11	76846611	missense	probably benign	0.25
R7380:Cpd	UTSW	11	76802325	nonsense	probably null
R7392:Cpd	UTSW	11	76801779	missense	probably damaging	1.00
R7410:Cpd	UTSW	11	76782308	missense	probably damaging	1.00
R7509:Cpd	UTSW	11	76797876	missense	probably benign	0.17
R7767:Cpd	UTSW	11	76813559	missense	probably benign	0.03
R8935:Cpd	UTSW	11	76840469	missense	probably damaging	1.00
R9151:Cpd	UTSW	11	76784449	missense	possibly damaging	0.54
R9172:Cpd	UTSW	11	76784426	missense	probably benign	0.21
R9173:Cpd	UTSW	11	76808823	missense	probably damaging	0.97
R9310:Cpd	UTSW	11	76814781	nonsense	probably null
Z1088:Cpd	UTSW	11	76801746	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACTGCAGTGCAATCCAAGAG -3'
(R):5'- GCAGTGTTCTCCCACTTGAAATC -3'

Sequencing Primer
(F):5'- TGCAATCCAAGAGCACCAAGTG -3'
(R):5'- TCCAAGGTAGACCTTGCA -3'

Posted On

2014-10-02