Incidental Mutation 'R2205:Dhrs7'
ID238998
Institutional Source Beutler Lab
Gene Symbol Dhrs7
Ensembl Gene ENSMUSG00000021094
Gene Namedehydrogenase/reductase (SDR family) member 7
SynonymsretSDR4, 2310016E22Rik, 5730564L20Rik, retDSR4
MMRRC Submission 040207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2205 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72650353-72664909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72656370 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 188 (V188E)
Ref Sequence ENSEMBL: ENSMUSP00000021512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021512] [ENSMUST00000220821]
Predicted Effect probably damaging
Transcript: ENSMUST00000021512
AA Change: V188E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021512
Gene: ENSMUSG00000021094
AA Change: V188E

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:KR 51 227 2.5e-11 PFAM
Pfam:adh_short 51 250 4.4e-52 PFAM
Pfam:adh_short_C2 57 267 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220821
Predicted Effect unknown
Transcript: ENSMUST00000221750
AA Change: V211E
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
5830473C10Rik A G 5: 90,569,562 T201A possibly damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca14 T C 7: 120,247,280 S652P probably damaging Het
Acsl6 G A 11: 54,324,007 G75S probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
Aknad1 A G 3: 108,757,293 D406G probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Arhgap35 A T 7: 16,498,025 probably null Het
Bag6 G A 17: 35,144,607 G751R probably damaging Het
Brat1 G A 5: 140,705,133 probably benign Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Catsperg1 G A 7: 29,185,246 Q922* probably null Het
Cfap221 T G 1: 119,936,104 Y570S possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cpd A G 11: 76,802,244 Y739H probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dpp9 A C 17: 56,199,287 I411S possibly damaging Het
Fitm2 G A 2: 163,472,596 probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpatch1 C A 7: 35,291,772 D616Y probably damaging Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Hoxb3 T A 11: 96,345,668 S191T probably benign Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Megf8 C T 7: 25,341,748 T1134I probably benign Het
Nipsnap1 C A 11: 4,889,974 H232N possibly damaging Het
Nme4 A T 17: 26,092,140 H150Q possibly damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
P2rx7 T A 5: 122,681,101 Y529N probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pofut1 T A 2: 153,261,247 M267K probably damaging Het
Rad54l2 T C 9: 106,717,798 D320G probably damaging Het
Rdm1 C A 11: 101,634,803 A225E probably damaging Het
Samm50 G A 15: 84,202,314 A245T probably benign Het
Scfd2 A T 5: 74,225,367 M597K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l2 T C 13: 112,898,890 I510V probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Tbc1d31 A G 15: 57,953,520 D717G probably benign Het
Tma7 C A 9: 109,082,226 probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Tns3 T C 11: 8,531,719 Y211C probably damaging Het
Ttc21b C T 2: 66,235,123 G436S possibly damaging Het
Ttn T C 2: 76,851,563 probably benign Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Usp34 A G 11: 23,385,147 T1210A probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Wdr62 T A 7: 30,258,149 probably null Het
Ywhah A G 5: 33,027,140 N229S probably damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Zswim4 G T 8: 84,225,869 T488N possibly damaging Het
Other mutations in Dhrs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dhrs7 APN 12 72659350 missense probably damaging 1.00
IGL00715:Dhrs7 APN 12 72652390 missense probably damaging 1.00
IGL02398:Dhrs7 APN 12 72664692 missense probably damaging 1.00
R0421:Dhrs7 UTSW 12 72653086 splice site probably benign
R0691:Dhrs7 UTSW 12 72652351 missense probably damaging 1.00
R1640:Dhrs7 UTSW 12 72652315 missense possibly damaging 0.86
R1696:Dhrs7 UTSW 12 72653120 missense possibly damaging 0.88
R1727:Dhrs7 UTSW 12 72659464 missense probably damaging 1.00
R1791:Dhrs7 UTSW 12 72653165 missense probably benign 0.13
R2046:Dhrs7 UTSW 12 72652266 missense possibly damaging 0.47
R2124:Dhrs7 UTSW 12 72653177 missense probably damaging 1.00
R2356:Dhrs7 UTSW 12 72652381 missense probably benign 0.00
R3431:Dhrs7 UTSW 12 72664727 missense probably damaging 0.99
R4492:Dhrs7 UTSW 12 72653125 missense probably damaging 1.00
R4744:Dhrs7 UTSW 12 72652251 missense possibly damaging 0.94
R4747:Dhrs7 UTSW 12 72653118 missense probably benign 0.03
R5050:Dhrs7 UTSW 12 72657410 missense probably damaging 1.00
R5076:Dhrs7 UTSW 12 72659481 missense probably benign 0.00
R5678:Dhrs7 UTSW 12 72657332 missense probably damaging 1.00
R6361:Dhrs7 UTSW 12 72664659 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGTGTGATGTGACTCCAAC -3'
(R):5'- TGACATTTTGGTCAACAACGG -3'

Sequencing Primer
(F):5'- TAAGGAGAGATACCAGCTTCCCTTG -3'
(R):5'- CATTTTGGTCAACAACGGTGGAAG -3'
Posted On2014-10-02