Incidental Mutation 'R0183:Sec14l3'
ID23900
Institutional Source Beutler Lab
Gene Symbol Sec14l3
Ensembl Gene ENSMUSG00000054986
Gene NameSEC14-like lipid binding 3
Synonyms
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0183 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location4064841-4077736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4075547 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 357 (S357L)
Ref Sequence ENSEMBL: ENSMUSP00000065084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068322]
Predicted Effect probably benign
Transcript: ENSMUST00000068322
AA Change: S357L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000065084
Gene: ENSMUSG00000054986
AA Change: S357L

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 2.71e-7 SMART
SEC14 76 247 1.18e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126396
Meta Mutation Damage Score 0.1323 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Sec14l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Sec14l3 APN 11 4076238 splice site probably benign
IGL01382:Sec14l3 APN 11 4068104 missense probably damaging 0.98
IGL02304:Sec14l3 APN 11 4074768 missense probably damaging 1.00
IGL02565:Sec14l3 APN 11 4076237 splice site probably benign
IGL02836:Sec14l3 APN 11 4070084 missense probably benign 0.02
R0597:Sec14l3 UTSW 11 4074814 missense probably damaging 1.00
R1425:Sec14l3 UTSW 11 4066487 missense probably damaging 1.00
R1834:Sec14l3 UTSW 11 4066510 splice site probably benign
R2090:Sec14l3 UTSW 11 4075481 missense probably benign 0.00
R3839:Sec14l3 UTSW 11 4071544 splice site probably null
R4424:Sec14l3 UTSW 11 4066210 missense probably damaging 1.00
R4948:Sec14l3 UTSW 11 4068101 missense possibly damaging 0.75
R5124:Sec14l3 UTSW 11 4075209 missense possibly damaging 0.67
R5588:Sec14l3 UTSW 11 4066138 missense probably damaging 1.00
R5635:Sec14l3 UTSW 11 4071484 missense probably damaging 1.00
R6185:Sec14l3 UTSW 11 4075244 missense probably damaging 1.00
R6192:Sec14l3 UTSW 11 4075566 splice site probably null
R6699:Sec14l3 UTSW 11 4075193 missense possibly damaging 0.78
R7002:Sec14l3 UTSW 11 4075263 missense possibly damaging 0.87
R7351:Sec14l3 UTSW 11 4074785 missense probably benign 0.00
R7357:Sec14l3 UTSW 11 4070127 missense probably benign 0.03
R7845:Sec14l3 UTSW 11 4067972 missense probably benign 0.38
R7890:Sec14l3 UTSW 11 4074795 missense probably damaging 0.96
R8108:Sec14l3 UTSW 11 4066198 missense probably damaging 1.00
RF011:Sec14l3 UTSW 11 4067963 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTGAGCAGCAACCTGTCCTCTTC -3'
(R):5'- TTGTGTCCTGTGATCCAAGCATCC -3'

Sequencing Primer
(F):5'- TCCTCTTCCAGGTGGCAG -3'
(R):5'- GTGATCCAAGCATCCTCAGTTC -3'
Posted On2013-04-16