Mutagenetix > Incidental Mutation

Incidental Mutation 'R2205:Vmn2r104'

239004

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

040207-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R2205 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20029821 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 729 (N729K)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

AlphaFold

E9Q2J5

Predicted Effect

probably benign
Transcript: ENSMUST00000168050
AA Change: N729K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: N729K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
5830473C10Rik	A	G	5: 90,569,562	T201A	possibly damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca14	T	C	7: 120,247,280	S652P	probably damaging	Het
Acsl6	G	A	11: 54,324,007	G75S	probably damaging	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
Aknad1	A	G	3: 108,757,293	D406G	probably damaging	Het
Ankrd2	C	A	19: 42,044,119	A273E	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Arhgap35	A	T	7: 16,498,025		probably null	Het
Bag6	G	A	17: 35,144,607	G751R	probably damaging	Het
Brat1	G	A	5: 140,705,133		probably benign	Het
Cacna1h	C	T	17: 25,380,260	A1742T	probably damaging	Het
Catsperg1	G	A	7: 29,185,246	Q922*	probably null	Het
Cfap221	T	G	1: 119,936,104	Y570S	possibly damaging	Het
Cfap45	T	C	1: 172,532,161	V76A	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cpd	A	G	11: 76,802,244	Y739H	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dhrs7	A	T	12: 72,656,370	V188E	probably damaging	Het
Dpp9	A	C	17: 56,199,287	I411S	possibly damaging	Het
Fitm2	G	A	2: 163,472,596		probably benign	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpatch1	C	A	7: 35,291,772	D616Y	probably damaging	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Hoxb3	T	A	11: 96,345,668	S191T	probably benign	Het
Ifit1bl1	C	T	19: 34,594,341	E239K	probably benign	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Megf8	C	T	7: 25,341,748	T1134I	probably benign	Het
Nipsnap1	C	A	11: 4,889,974	H232N	possibly damaging	Het
Nme4	A	T	17: 26,092,140	H150Q	possibly damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
P2rx7	T	A	5: 122,681,101	Y529N	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pofut1	T	A	2: 153,261,247	M267K	probably damaging	Het
Rad54l2	T	C	9: 106,717,798	D320G	probably damaging	Het
Rdm1	C	A	11: 101,634,803	A225E	probably damaging	Het
Samm50	G	A	15: 84,202,314	A245T	probably benign	Het
Scfd2	A	T	5: 74,225,367	M597K	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skiv2l2	T	C	13: 112,898,890	I510V	probably benign	Het
Ssh3	A	G	19: 4,269,073	L3P	probably damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Tbc1d31	A	G	15: 57,953,520	D717G	probably benign	Het
Tma7	C	A	9: 109,082,226		probably benign	Het
Tmc1	A	T	19: 20,940,905	L2M	probably benign	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Tns3	T	C	11: 8,531,719	Y211C	probably damaging	Het
Ttc21b	C	T	2: 66,235,123	G436S	possibly damaging	Het
Ttn	T	C	2: 76,851,563		probably benign	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Usp34	A	G	11: 23,385,147	T1210A	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Wdr62	T	A	7: 30,258,149		probably null	Het
Ywhah	A	G	5: 33,027,140	N229S	probably damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,183,446	A139D	probably damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het
Zswim4	G	T	8: 84,225,869	T488N	possibly damaging	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
R8691:Vmn2r104	UTSW	17	20041848	missense	probably damaging	0.98
R8795:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8900:Vmn2r104	UTSW	17	20041662	missense	probably damaging	0.99
R8913:Vmn2r104	UTSW	17	20029706	missense	probably damaging	1.00
R9180:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9199:Vmn2r104	UTSW	17	20041835	missense	probably damaging	0.99
R9282:Vmn2r104	UTSW	17	20040836	missense	probably damaging	1.00
R9303:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9305:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9322:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9325:Vmn2r104	UTSW	17	20048171	missense	possibly damaging	0.95
R9414:Vmn2r104	UTSW	17	20029988	missense	probably damaging	0.99
R9785:Vmn2r104	UTSW	17	20048147	missense	probably benign
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTTTAGTGCTGTGGTAGAC -3'
(R):5'- CAGACCACCTTTGCAGTTGC -3'

Sequencing Primer
(F):5'- GGTGACCCAGACACAGAAGAAC -3'
(R):5'- CACTGTGTTGGCCAAAGCTATTACTG -3'

Posted On

2014-10-02