Incidental Mutation 'R2206:Col9a2'
ID 239029
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission 040208-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2206 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 120911455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 599 (R599G)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.3183 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 130,964,331 (GRCm39) C24S probably benign Het
2410137M14Rik A G 17: 37,288,965 (GRCm39) probably benign Het
Abhd18 G A 3: 40,865,008 (GRCm39) G83D probably benign Het
Adam34 T C 8: 44,105,274 (GRCm39) I124V probably benign Het
Adck2 A G 6: 39,560,773 (GRCm39) D123G probably damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Axl T C 7: 25,470,061 (GRCm39) Y466C probably damaging Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Bpifb9a A T 2: 154,106,161 (GRCm39) probably null Het
Brip1 A G 11: 85,952,703 (GRCm39) V1026A probably benign Het
Cacna1h A T 17: 25,603,987 (GRCm39) S1282T probably benign Het
Calcr T C 6: 3,717,133 (GRCm39) Y109C probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Cst13 A T 2: 148,665,202 (GRCm39) R66W probably damaging Het
Cstf2t A G 19: 31,061,175 (GRCm39) N237S probably benign Het
Dhx8 A G 11: 101,641,797 (GRCm39) T632A probably benign Het
Disp2 G T 2: 118,622,725 (GRCm39) Q1152H probably benign Het
Dlg1 A G 16: 31,672,664 (GRCm39) H599R probably benign Het
Dmxl1 T C 18: 50,027,161 (GRCm39) S2090P probably benign Het
Dnajc13 C G 9: 104,080,717 (GRCm39) V821L probably damaging Het
Dop1a T A 9: 86,403,652 (GRCm39) H1617Q probably benign Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Ephb4 T C 5: 137,355,981 (GRCm39) C197R probably damaging Het
Foxn1 C A 11: 78,249,630 (GRCm39) A632S probably benign Het
Fpr3 A C 17: 18,190,908 (GRCm39) T60P probably damaging Het
Gja4 A T 4: 127,206,410 (GRCm39) S118T probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Itfg1 A T 8: 86,502,827 (GRCm39) S246R probably benign Het
Kazn A T 4: 141,845,603 (GRCm39) probably null Het
Mdn1 T C 4: 32,716,271 (GRCm39) L2111P possibly damaging Het
Myo6 A G 9: 80,165,737 (GRCm39) Y374C probably benign Het
Odad2 C A 18: 7,223,676 (GRCm39) G456W probably benign Het
Or1a1 G T 11: 74,087,150 (GRCm39) V274L possibly damaging Het
Or1j16 G T 2: 36,530,201 (GRCm39) R50M possibly damaging Het
Or5b99 A G 19: 12,976,404 (GRCm39) D18G probably benign Het
Or9m1b A G 2: 87,836,579 (GRCm39) V181A probably benign Het
Pcdhb15 A T 18: 37,608,075 (GRCm39) T436S probably benign Het
Pcdhb18 T A 18: 37,624,342 (GRCm39) N557K probably damaging Het
Pcdhb6 T C 18: 37,468,633 (GRCm39) M518T probably benign Het
Pcmtd1 A T 1: 7,239,807 (GRCm39) I83L probably benign Het
Pitrm1 T A 13: 6,619,327 (GRCm39) Y721N probably damaging Het
Prcp C T 7: 92,577,820 (GRCm39) T328I probably damaging Het
Psg27 C A 7: 18,301,036 (GRCm39) E6* probably null Het
Pth1r T A 9: 110,552,655 (GRCm39) E465V probably damaging Het
Pus7l T C 15: 94,421,471 (GRCm39) Y613C probably damaging Het
Rsl1 A G 13: 67,330,892 (GRCm39) T447A probably benign Het
Setd3 C T 12: 108,073,544 (GRCm39) V578M probably benign Het
Slc10a1 T C 12: 81,014,402 (GRCm39) N106S probably damaging Het
Slc29a3 T C 10: 60,551,686 (GRCm39) M453V possibly damaging Het
Slc4a8 T C 15: 100,705,326 (GRCm39) V844A probably damaging Het
Sorcs1 T C 19: 50,218,655 (GRCm39) H609R possibly damaging Het
Spata31d1e A G 13: 59,890,920 (GRCm39) V300A probably benign Het
Tmppe C G 9: 114,234,640 (GRCm39) P313R probably benign Het
Tnxb A C 17: 34,928,391 (GRCm39) T2602P possibly damaging Het
Trip11 T C 12: 101,839,701 (GRCm39) N1643S probably benign Het
Trmt1l T C 1: 151,311,594 (GRCm39) probably null Het
Vmn1r177 A T 7: 23,565,556 (GRCm39) C107S probably damaging Het
Vmn1r225 A G 17: 20,722,611 (GRCm39) I17M possibly damaging Het
Vmn1r232 A G 17: 21,134,465 (GRCm39) L45P probably benign Het
Wdr7 T A 18: 63,910,678 (GRCm39) V690E possibly damaging Het
Xaf1 A T 11: 72,194,228 (GRCm39) E36D possibly damaging Het
Zbtb40 G A 4: 136,744,596 (GRCm39) Q275* probably null Het
Zfp513 T G 5: 31,357,767 (GRCm39) K202T probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTGGTACATAGTAAATGCCAG -3'
(R):5'- ATGCCAGGCTTCCACAAAG -3'

Sequencing Primer
(F):5'- GCCAGTTATGTATTGGACAATTTCC -3'
(R):5'- GAAAGCCCAGATGCCCATGG -3'
Posted On 2014-10-02