Incidental Mutation 'R2206:Prcp'
ID239045
Institutional Source Beutler Lab
Gene Symbol Prcp
Ensembl Gene ENSMUSG00000061119
Gene Nameprolylcarboxypeptidase (angiotensinase C)
Synonyms2510048K03Rik, 2610104A14Rik
MMRRC Submission 040208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2206 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location92874470-92934583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92928612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 328 (T328I)
Ref Sequence ENSEMBL: ENSMUSP00000146597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076052] [ENSMUST00000207594]
Predicted Effect probably damaging
Transcript: ENSMUST00000076052
AA Change: T363I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075429
Gene: ENSMUSG00000061119
AA Change: T363I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Peptidase_S37 20 211 1.4e-4 PFAM
Pfam:Peptidase_S28 53 475 3.4e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207594
AA Change: T328I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body length, weight, and fat pads with resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2310057M21Rik A T 7: 131,362,602 C24S probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
Abhd18 G A 3: 40,910,573 G83D probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Adck2 A G 6: 39,583,839 D123G probably damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Axl T C 7: 25,770,636 Y466C probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9a A T 2: 154,264,241 probably null Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Cstf2t A G 19: 31,083,775 N237S probably benign Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp2 G T 2: 118,792,244 Q1152H probably benign Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dmxl1 T C 18: 49,894,094 S2090P probably benign Het
Dnajc13 C G 9: 104,203,518 V821L probably damaging Het
Dopey1 T A 9: 86,521,599 H1617Q probably benign Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Ephb4 T C 5: 137,357,719 C197R probably damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fpr3 A C 17: 17,970,646 T60P probably damaging Het
Gja4 A T 4: 127,312,617 S118T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kazn A T 4: 142,118,292 probably null Het
Mdn1 T C 4: 32,716,271 L2111P possibly damaging Het
Myo6 A G 9: 80,258,455 Y374C probably benign Het
Olfr1160 A G 2: 88,006,235 V181A probably benign Het
Olfr1451 A G 19: 12,999,040 D18G probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pcmtd1 A T 1: 7,169,583 I83L probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Psg27 C A 7: 18,567,111 E6* probably null Het
Pth1r T A 9: 110,723,587 E465V probably damaging Het
Pus7l T C 15: 94,523,590 Y613C probably damaging Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Slc10a1 T C 12: 80,967,628 N106S probably damaging Het
Slc29a3 T C 10: 60,715,907 M453V possibly damaging Het
Slc4a8 T C 15: 100,807,445 V844A probably damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Tmppe C G 9: 114,405,572 P313R probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Trmt1l T C 1: 151,435,843 probably null Het
Vmn1r177 A T 7: 23,866,131 C107S probably damaging Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zbtb40 G A 4: 137,017,285 Q275* probably null Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Other mutations in Prcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Prcp APN 7 92933099 missense probably benign 0.00
IGL01124:Prcp APN 7 92910208 missense probably benign 0.01
IGL01538:Prcp APN 7 92910213 missense probably benign 0.09
IGL02005:Prcp APN 7 92927824 missense probably benign 0.01
IGL02160:Prcp APN 7 92917761 missense probably benign 0.02
IGL02548:Prcp APN 7 92901174 missense probably damaging 0.98
R0140:Prcp UTSW 7 92928611 missense probably damaging 1.00
R0480:Prcp UTSW 7 92919082 missense probably damaging 1.00
R0989:Prcp UTSW 7 92910216 missense probably benign 0.04
R1216:Prcp UTSW 7 92917746 missense probably benign
R1596:Prcp UTSW 7 92917834 intron probably benign
R1823:Prcp UTSW 7 92928675 missense probably damaging 0.98
R2132:Prcp UTSW 7 92901280 missense probably benign 0.01
R4761:Prcp UTSW 7 92917725 splice site probably null
R5000:Prcp UTSW 7 92919160 missense probably damaging 0.99
R5320:Prcp UTSW 7 92928635 missense probably benign 0.01
R5969:Prcp UTSW 7 92917766 missense probably benign 0.01
R6013:Prcp UTSW 7 92927768 missense possibly damaging 0.72
R6298:Prcp UTSW 7 92928633 missense probably damaging 1.00
R7733:Prcp UTSW 7 92901298 missense probably damaging 1.00
R7852:Prcp UTSW 7 92928692 missense probably benign 0.33
R7935:Prcp UTSW 7 92928692 missense probably benign 0.33
R8032:Prcp UTSW 7 92928698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCCCTAGCTGAATGAC -3'
(R):5'- TCAGCCATCCTGCAAGTGTC -3'

Sequencing Primer
(F):5'- AGTCCCTAGCTGAATGACCTTGAC -3'
(R):5'- TGCAAGTGTCTCCATCAACCAG -3'
Posted On2014-10-02