Incidental Mutation 'R2206:Pth1r'
ID 239055
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Name parathyroid hormone 1 receptor
Synonyms PTH-related peptide receptor, PPR, PTH1R, Pthr1, PTH/PTHrP receptor
MMRRC Submission 040208-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2206 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 110722085-110747145 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110723587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 465 (E465V)
Ref Sequence ENSEMBL: ENSMUSP00000143298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000199862]
AlphaFold P41593
Predicted Effect probably damaging
Transcript: ENSMUST00000006005
AA Change: E465V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492
AA Change: E465V

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166716
AA Change: E465V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492
AA Change: E465V

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198865
AA Change: E465V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492
AA Change: E465V

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2310057M21Rik A T 7: 131,362,602 C24S probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
Abhd18 G A 3: 40,910,573 G83D probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Adck2 A G 6: 39,583,839 D123G probably damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Axl T C 7: 25,770,636 Y466C probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9a A T 2: 154,264,241 probably null Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Cstf2t A G 19: 31,083,775 N237S probably benign Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp2 G T 2: 118,792,244 Q1152H probably benign Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dmxl1 T C 18: 49,894,094 S2090P probably benign Het
Dnajc13 C G 9: 104,203,518 V821L probably damaging Het
Dopey1 T A 9: 86,521,599 H1617Q probably benign Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Ephb4 T C 5: 137,357,719 C197R probably damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fpr3 A C 17: 17,970,646 T60P probably damaging Het
Gja4 A T 4: 127,312,617 S118T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kazn A T 4: 142,118,292 probably null Het
Mdn1 T C 4: 32,716,271 L2111P possibly damaging Het
Myo6 A G 9: 80,258,455 Y374C probably benign Het
Olfr1160 A G 2: 88,006,235 V181A probably benign Het
Olfr1451 A G 19: 12,999,040 D18G probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pcmtd1 A T 1: 7,169,583 I83L probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Prcp C T 7: 92,928,612 T328I probably damaging Het
Psg27 C A 7: 18,567,111 E6* probably null Het
Pus7l T C 15: 94,523,590 Y613C probably damaging Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Slc10a1 T C 12: 80,967,628 N106S probably damaging Het
Slc29a3 T C 10: 60,715,907 M453V possibly damaging Het
Slc4a8 T C 15: 100,807,445 V844A probably damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Tmppe C G 9: 114,405,572 P313R probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Trmt1l T C 1: 151,435,843 probably null Het
Vmn1r177 A T 7: 23,866,131 C107S probably damaging Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zbtb40 G A 4: 137,017,285 Q275* probably null Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110727130 missense probably damaging 0.99
IGL01682:Pth1r APN 9 110723706 splice site probably null
IGL02004:Pth1r APN 9 110742308 intron probably benign
IGL02169:Pth1r APN 9 110724435 missense probably damaging 1.00
IGL02548:Pth1r APN 9 110727680 missense probably damaging 1.00
IGL03201:Pth1r APN 9 110722580 missense probably damaging 1.00
R0070:Pth1r UTSW 9 110727550 splice site probably null
R0881:Pth1r UTSW 9 110731573 missense probably damaging 1.00
R1022:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1022:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R1024:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1024:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R2071:Pth1r UTSW 9 110727013 missense probably benign 0.34
R2197:Pth1r UTSW 9 110726990 unclassified probably benign
R4184:Pth1r UTSW 9 110742232 start codon destroyed probably null
R4590:Pth1r UTSW 9 110722271 missense probably benign 0.04
R4638:Pth1r UTSW 9 110727073 missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110731624 missense probably damaging 1.00
R5457:Pth1r UTSW 9 110726454 missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110722316 missense possibly damaging 0.64
R6682:Pth1r UTSW 9 110727251 splice site probably null
R6683:Pth1r UTSW 9 110727251 splice site probably null
R6914:Pth1r UTSW 9 110728016 splice site probably null
R6942:Pth1r UTSW 9 110728016 splice site probably null
R7164:Pth1r UTSW 9 110723747 missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110722393 missense probably benign
R7883:Pth1r UTSW 9 110731558 missense probably benign 0.02
R8966:Pth1r UTSW 9 110725161 missense possibly damaging 0.79
R9168:Pth1r UTSW 9 110727136 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTGAGGAACCCAGCTTGCTC -3'
(R):5'- ACACCGTCTTCATGGCCTTG -3'

Sequencing Primer
(F):5'- TGCCTGCTGCTACCACC -3'
(R):5'- TACACCGAGGTCTCAGGGAC -3'
Posted On 2014-10-02