Incidental Mutation 'R0183:Card14'
ID23906
Institutional Source Beutler Lab
Gene Symbol Card14
Ensembl Gene ENSMUSG00000013483
Gene Namecaspase recruitment domain family, member 14
SynonymsBimp2, CARMA2
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0183 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location119307768-119345375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119326698 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 386 (R386C)
Ref Sequence ENSEMBL: ENSMUSP00000101857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053245] [ENSMUST00000106250]
Predicted Effect probably damaging
Transcript: ENSMUST00000053245
AA Change: R386C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053665
Gene: ENSMUSG00000013483
AA Change: R386C

DomainStartEndE-ValueType
Pfam:CARD 20 106 4.1e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106250
AA Change: R386C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101857
Gene: ENSMUSG00000013483
AA Change: R386C

DomainStartEndE-ValueType
Pfam:CARD 20 106 2.8e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151052
Meta Mutation Damage Score 0.2166 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Card14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Card14 APN 11 119343145 missense probably benign 0.10
IGL02070:Card14 APN 11 119344704 missense probably damaging 1.00
IGL02632:Card14 APN 11 119338904 missense probably benign 0.02
R0614:Card14 UTSW 11 119322827 missense probably benign
R0766:Card14 UTSW 11 119324176 missense probably damaging 1.00
R1033:Card14 UTSW 11 119338370 missense probably damaging 1.00
R1705:Card14 UTSW 11 119338406 missense possibly damaging 0.77
R1907:Card14 UTSW 11 119331259 missense probably benign 0.00
R1992:Card14 UTSW 11 119321821 critical splice acceptor site probably null
R3729:Card14 UTSW 11 119333932 missense probably damaging 1.00
R4472:Card14 UTSW 11 119333958 missense possibly damaging 0.77
R4578:Card14 UTSW 11 119326741 missense probably benign 0.20
R4763:Card14 UTSW 11 119343175 missense probably damaging 0.99
R5117:Card14 UTSW 11 119338250 missense probably damaging 0.99
R5386:Card14 UTSW 11 119317289 missense probably damaging 1.00
R6457:Card14 UTSW 11 119339602 nonsense probably null
R6622:Card14 UTSW 11 119333988 missense probably benign 0.06
R6998:Card14 UTSW 11 119322899 missense probably damaging 1.00
R7269:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7304:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7310:Card14 UTSW 11 119326179 missense probably null 1.00
R7612:Card14 UTSW 11 119333579 missense possibly damaging 0.52
R7689:Card14 UTSW 11 119325502 missense possibly damaging 0.66
Z1177:Card14 UTSW 11 119341061 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTTTTGCAGCTCAGGTGACTG -3'
(R):5'- TTGTGACACAGCTCTCAAGCACCC -3'

Sequencing Primer
(F):5'- GTGACTGGCTCTGATGTTCTACC -3'
(R):5'- ACAGTGTCTGTGTCACTCAG -3'
Posted On2013-04-16