Incidental Mutation 'R2206:Olfr403'
ID239061
Institutional Source Beutler Lab
Gene Symbol Olfr403
Ensembl Gene ENSMUSG00000070378
Gene Nameolfactory receptor 403
SynonymsMOR125-5_p, IA7, GA_x6K02T2P1NL-4348188-4349129
MMRRC Submission 040208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2206 (G1)
Quality Score148
Status Not validated
Chromosome11
Chromosomal Location74186249-74198612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74196324 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 274 (V274L)
Ref Sequence ENSEMBL: ENSMUSP00000145741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076675] [ENSMUST00000206114]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076675
AA Change: V274L

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075971
Gene: ENSMUSG00000070378
AA Change: V274L

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.3e-59 PFAM
Pfam:7tm_1 41 238 7.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206114
AA Change: V274L

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206247
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2310057M21Rik A T 7: 131,362,602 C24S probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
Abhd18 G A 3: 40,910,573 G83D probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Adck2 A G 6: 39,583,839 D123G probably damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Axl T C 7: 25,770,636 Y466C probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9a A T 2: 154,264,241 probably null Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Cstf2t A G 19: 31,083,775 N237S probably benign Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp2 G T 2: 118,792,244 Q1152H probably benign Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dmxl1 T C 18: 49,894,094 S2090P probably benign Het
Dnajc13 C G 9: 104,203,518 V821L probably damaging Het
Dopey1 T A 9: 86,521,599 H1617Q probably benign Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Ephb4 T C 5: 137,357,719 C197R probably damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fpr3 A C 17: 17,970,646 T60P probably damaging Het
Gja4 A T 4: 127,312,617 S118T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kazn A T 4: 142,118,292 probably null Het
Mdn1 T C 4: 32,716,271 L2111P possibly damaging Het
Myo6 A G 9: 80,258,455 Y374C probably benign Het
Olfr1160 A G 2: 88,006,235 V181A probably benign Het
Olfr1451 A G 19: 12,999,040 D18G probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pcmtd1 A T 1: 7,169,583 I83L probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Prcp C T 7: 92,928,612 T328I probably damaging Het
Psg27 C A 7: 18,567,111 E6* probably null Het
Pth1r T A 9: 110,723,587 E465V probably damaging Het
Pus7l T C 15: 94,523,590 Y613C probably damaging Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Slc10a1 T C 12: 80,967,628 N106S probably damaging Het
Slc29a3 T C 10: 60,715,907 M453V possibly damaging Het
Slc4a8 T C 15: 100,807,445 V844A probably damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Tmppe C G 9: 114,405,572 P313R probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Trmt1l T C 1: 151,435,843 probably null Het
Vmn1r177 A T 7: 23,866,131 C107S probably damaging Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zbtb40 G A 4: 137,017,285 Q275* probably null Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Other mutations in Olfr403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Olfr403 APN 11 74195761 missense probably damaging 1.00
IGL01716:Olfr403 APN 11 74196381 missense probably benign 0.01
R0598:Olfr403 UTSW 11 74195832 missense possibly damaging 0.90
R1168:Olfr403 UTSW 11 74196421 missense probably benign
R1440:Olfr403 UTSW 11 74195679 missense probably damaging 1.00
R1657:Olfr403 UTSW 11 74195896 missense probably damaging 0.98
R1834:Olfr403 UTSW 11 74195653 missense probably benign 0.00
R1990:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R1991:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R2207:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R3103:Olfr403 UTSW 11 74196075 missense probably benign 0.39
R4662:Olfr403 UTSW 11 74195716 missense probably damaging 1.00
R4844:Olfr403 UTSW 11 74196076 missense probably damaging 0.98
R5336:Olfr403 UTSW 11 74196033 missense probably damaging 1.00
R5918:Olfr403 UTSW 11 74196118 missense probably damaging 0.96
R6858:Olfr403 UTSW 11 74196099 missense probably benign 0.01
R7175:Olfr403 UTSW 11 74196178 nonsense probably null
R7362:Olfr403 UTSW 11 74195586 missense probably benign 0.01
R7670:Olfr403 UTSW 11 74196207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCTGTGCATCATCATC -3'
(R):5'- GATGACAAGCAGCTTCTTGC -3'

Sequencing Primer
(F):5'- GCATCATCATCTCCTATGTCCGGG -3'
(R):5'- ACATTGAAGCTGAGTTTCCTAGTGC -3'
Posted On2014-10-02