Incidental Mutation 'R2206:Slc4a8'
ID239075
Institutional Source Beutler Lab
Gene Symbol Slc4a8
Ensembl Gene ENSMUSG00000023032
Gene Namesolute carrier family 4 (anion exchanger), member 8
SynonymsNDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3
MMRRC Submission 040208-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R2206 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100761747-100823968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100807445 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 844 (V844A)
Ref Sequence ENSEMBL: ENSMUSP00000125090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023776] [ENSMUST00000162049]
Predicted Effect probably benign
Transcript: ENSMUST00000023776
AA Change: V896A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023776
Gene: ENSMUSG00000023032
AA Change: V896A

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Pfam:Band_3_cyto 145 402 1.4e-105 PFAM
Pfam:HCO3_cotransp 443 956 9.6e-247 PFAM
transmembrane domain 964 986 N/A INTRINSIC
low complexity region 1010 1027 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162049
AA Change: V844A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125090
Gene: ENSMUSG00000023032
AA Change: V844A

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
Pfam:Band_3_cyto 93 350 6.5e-103 PFAM
Pfam:HCO3_cotransp 390 904 1.6e-251 PFAM
transmembrane domain 912 934 N/A INTRINSIC
low complexity region 958 975 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162805
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that functions to transport sodium and bicarbonate ions across the cell membrane. The encoded protein is important for pH regulation in neurons. The activity of this protein can be inhibited by 4,4'-Di-isothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal sodium and chloride ion excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2310057M21Rik A T 7: 131,362,602 C24S probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
Abhd18 G A 3: 40,910,573 G83D probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Adck2 A G 6: 39,583,839 D123G probably damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Axl T C 7: 25,770,636 Y466C probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9a A T 2: 154,264,241 probably null Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Cstf2t A G 19: 31,083,775 N237S probably benign Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp2 G T 2: 118,792,244 Q1152H probably benign Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dmxl1 T C 18: 49,894,094 S2090P probably benign Het
Dnajc13 C G 9: 104,203,518 V821L probably damaging Het
Dopey1 T A 9: 86,521,599 H1617Q probably benign Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Ephb4 T C 5: 137,357,719 C197R probably damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fpr3 A C 17: 17,970,646 T60P probably damaging Het
Gja4 A T 4: 127,312,617 S118T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kazn A T 4: 142,118,292 probably null Het
Mdn1 T C 4: 32,716,271 L2111P possibly damaging Het
Myo6 A G 9: 80,258,455 Y374C probably benign Het
Olfr1160 A G 2: 88,006,235 V181A probably benign Het
Olfr1451 A G 19: 12,999,040 D18G probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pcmtd1 A T 1: 7,169,583 I83L probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Prcp C T 7: 92,928,612 T328I probably damaging Het
Psg27 C A 7: 18,567,111 E6* probably null Het
Pth1r T A 9: 110,723,587 E465V probably damaging Het
Pus7l T C 15: 94,523,590 Y613C probably damaging Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Slc10a1 T C 12: 80,967,628 N106S probably damaging Het
Slc29a3 T C 10: 60,715,907 M453V possibly damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Tmppe C G 9: 114,405,572 P313R probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Trmt1l T C 1: 151,435,843 probably null Het
Vmn1r177 A T 7: 23,866,131 C107S probably damaging Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zbtb40 G A 4: 137,017,285 Q275* probably null Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Other mutations in Slc4a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Slc4a8 APN 15 100807438 missense possibly damaging 0.50
IGL01633:Slc4a8 APN 15 100787247 missense probably damaging 1.00
IGL02945:Slc4a8 APN 15 100807199 critical splice acceptor site probably null
IGL03172:Slc4a8 APN 15 100799717 missense probably benign
R0008:Slc4a8 UTSW 15 100800493 missense possibly damaging 0.67
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0257:Slc4a8 UTSW 15 100784880 splice site probably benign
R0393:Slc4a8 UTSW 15 100774638 missense probably damaging 0.99
R0508:Slc4a8 UTSW 15 100789092 missense probably benign 0.01
R0639:Slc4a8 UTSW 15 100796550 missense probably damaging 1.00
R1640:Slc4a8 UTSW 15 100783787 missense probably benign 0.13
R1692:Slc4a8 UTSW 15 100800573 missense probably damaging 1.00
R1766:Slc4a8 UTSW 15 100787212 missense probably benign 0.00
R1955:Slc4a8 UTSW 15 100807376 missense probably damaging 1.00
R2157:Slc4a8 UTSW 15 100806373 missense probably damaging 1.00
R2229:Slc4a8 UTSW 15 100809299 missense probably damaging 1.00
R2274:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R2275:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R4299:Slc4a8 UTSW 15 100796640 critical splice donor site probably null
R4482:Slc4a8 UTSW 15 100810599 missense probably damaging 1.00
R5038:Slc4a8 UTSW 15 100795821 missense probably damaging 0.98
R5586:Slc4a8 UTSW 15 100787164 missense probably damaging 1.00
R5594:Slc4a8 UTSW 15 100795887 missense probably damaging 1.00
R5804:Slc4a8 UTSW 15 100791625 missense possibly damaging 0.71
R5815:Slc4a8 UTSW 15 100788211 missense probably benign 0.42
R5921:Slc4a8 UTSW 15 100814447 splice site probably benign
R6029:Slc4a8 UTSW 15 100807339 missense probably benign 0.00
R6212:Slc4a8 UTSW 15 100811571 missense possibly damaging 0.69
R6321:Slc4a8 UTSW 15 100789164 missense probably damaging 0.99
R6574:Slc4a8 UTSW 15 100807316 missense probably damaging 1.00
R6829:Slc4a8 UTSW 15 100800538 missense probably damaging 1.00
R7023:Slc4a8 UTSW 15 100791643 missense probably benign 0.00
R7082:Slc4a8 UTSW 15 100791027 missense probably damaging 1.00
R7197:Slc4a8 UTSW 15 100790976 missense probably damaging 1.00
R7352:Slc4a8 UTSW 15 100790984 missense probably damaging 1.00
R7391:Slc4a8 UTSW 15 100784862 missense probably damaging 0.98
R7627:Slc4a8 UTSW 15 100788223 missense probably benign 0.08
R7810:Slc4a8 UTSW 15 100798178 missense possibly damaging 0.72
R8026:Slc4a8 UTSW 15 100787289 missense possibly damaging 0.72
Z1088:Slc4a8 UTSW 15 100761951 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTTGCTCCATCATGGGCC -3'
(R):5'- CCCCAGCATAAAGGAGCTAGAG -3'

Sequencing Primer
(F):5'- ATCATGGGCCTGCCTTGG -3'
(R):5'- GGATCACGTGTTCTATTCTATCACTG -3'
Posted On2014-10-02