Mutagenetix > Incidental Mutations

Incidental Mutation 'R2206:Armc4'

239085

Institutional Source

Beutler Lab

Gene Symbol

Armc4

Ensembl Gene

ENSMUSG00000061802

Gene Name

armadillo repeat containing 4

Synonyms

b2b643Clo, 4930463I21Rik, b2b227.1Clo

MMRRC Submission

040208-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R2206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7088233-7297901 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 7223676 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 456 (G456W)

Ref Sequence

ENSEMBL: ENSMUSP00000080028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081275]

Predicted Effect

probably benign
Transcript: ENSMUST00000081275
AA Change: G456W

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: G456W

Domain	Start	End	E-Value	Type
low complexity region	172	186	N/A	INTRINSIC
low complexity region	410	428	N/A	INTRINSIC
ARM	475	516	1.38e1	SMART
ARM	517	557	2.38e-2	SMART
ARM	558	613	3.97e0	SMART
ARM	614	654	2.59e-3	SMART
ARM	655	695	3.48e1	SMART
ARM	696	737	1.6e1	SMART
ARM	738	778	4.09e0	SMART
ARM	779	819	9.68e0	SMART
ARM	861	903	3.52e0	SMART
ARM	904	944	1.26e1	SMART
ARM	945	985	1.03e1	SMART
ARM	986	1026	1.13e-3	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,106	V300A	probably benign	Het
2310057M21Rik	A	T	7: 131,362,602	C24S	probably benign	Het
2410137M14Rik	A	G	17: 36,978,073		probably benign	Het
Abhd18	G	A	3: 40,910,573	G83D	probably benign	Het
Adam34	T	C	8: 43,652,237	I124V	probably benign	Het
Adck2	A	G	6: 39,583,839	D123G	probably damaging	Het
Arhgef2	A	G	3: 88,629,914	E37G	probably damaging	Het
Axl	T	C	7: 25,770,636	Y466C	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9a	A	T	2: 154,264,241		probably null	Het
Brip1	A	G	11: 86,061,877	V1026A	probably benign	Het
Cacna1h	A	T	17: 25,385,013	S1282T	probably benign	Het
Calcr	T	C	6: 3,717,133	Y109C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cst13	A	T	2: 148,823,282	R66W	probably damaging	Het
Cstf2t	A	G	19: 31,083,775	N237S	probably benign	Het
Dhx8	A	G	11: 101,750,971	T632A	probably benign	Het
Disp2	G	T	2: 118,792,244	Q1152H	probably benign	Het
Dlg1	A	G	16: 31,853,846	H599R	probably benign	Het
Dmxl1	T	C	18: 49,894,094	S2090P	probably benign	Het
Dnajc13	C	G	9: 104,203,518	V821L	probably damaging	Het
Dopey1	T	A	9: 86,521,599	H1617Q	probably benign	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Ephb4	T	C	5: 137,357,719	C197R	probably damaging	Het
Foxn1	C	A	11: 78,358,804	A632S	probably benign	Het
Fpr3	A	C	17: 17,970,646	T60P	probably damaging	Het
Gja4	A	T	4: 127,312,617	S118T	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itfg1	A	T	8: 85,776,198	S246R	probably benign	Het
Kazn	A	T	4: 142,118,292		probably null	Het
Mdn1	T	C	4: 32,716,271	L2111P	possibly damaging	Het
Myo6	A	G	9: 80,258,455	Y374C	probably benign	Het
Olfr1160	A	G	2: 88,006,235	V181A	probably benign	Het
Olfr1451	A	G	19: 12,999,040	D18G	probably benign	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr403	G	T	11: 74,196,324	V274L	possibly damaging	Het
Pcdhb15	A	T	18: 37,475,022	T436S	probably benign	Het
Pcdhb18	T	A	18: 37,491,289	N557K	probably damaging	Het
Pcdhb6	T	C	18: 37,335,580	M518T	probably benign	Het
Pcmtd1	A	T	1: 7,169,583	I83L	probably benign	Het
Pitrm1	T	A	13: 6,569,291	Y721N	probably damaging	Het
Prcp	C	T	7: 92,928,612	T328I	probably damaging	Het
Psg27	C	A	7: 18,567,111	E6*	probably null	Het
Pth1r	T	A	9: 110,723,587	E465V	probably damaging	Het
Pus7l	T	C	15: 94,523,590	Y613C	probably damaging	Het
Rsl1	A	G	13: 67,182,828	T447A	probably benign	Het
Setd3	C	T	12: 108,107,285	V578M	probably benign	Het
Slc10a1	T	C	12: 80,967,628	N106S	probably damaging	Het
Slc29a3	T	C	10: 60,715,907	M453V	possibly damaging	Het
Slc4a8	T	C	15: 100,807,445	V844A	probably damaging	Het
Sorcs1	T	C	19: 50,230,217	H609R	possibly damaging	Het
Tmppe	C	G	9: 114,405,572	P313R	probably benign	Het
Tnxb	A	C	17: 34,709,417	T2602P	possibly damaging	Het
Trip11	T	C	12: 101,873,442	N1643S	probably benign	Het
Trmt1l	T	C	1: 151,435,843		probably null	Het
Vmn1r177	A	T	7: 23,866,131	C107S	probably damaging	Het
Vmn1r225	A	G	17: 20,502,349	I17M	possibly damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Wdr7	T	A	18: 63,777,607	V690E	possibly damaging	Het
Xaf1	A	T	11: 72,303,402	E36D	possibly damaging	Het
Zbtb40	G	A	4: 137,017,285	Q275*	probably null	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het

Other mutations in Armc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Armc4	APN	18	7211504	missense	probably damaging	0.96
IGL00822:Armc4	APN	18	7181817	missense	probably damaging	1.00
IGL01345:Armc4	APN	18	7266947	missense	probably benign	0.00
IGL01593:Armc4	APN	18	7127345	missense	probably benign	0.00
IGL01645:Armc4	APN	18	7268491	missense	probably benign	0.00
IGL01863:Armc4	APN	18	7222617	missense	probably damaging	1.00
IGL01955:Armc4	APN	18	7127291	missense	possibly damaging	0.89
IGL02013:Armc4	APN	18	7265157	splice site	probably benign
IGL02142:Armc4	APN	18	7214601	missense	probably damaging	1.00
IGL02399:Armc4	APN	18	7285719	missense	probably benign
IGL02439:Armc4	APN	18	7268444	missense	probably benign	0.04
IGL02452:Armc4	APN	18	7129461	missense	probably damaging	1.00
IGL02632:Armc4	APN	18	7214727	splice site	probably benign
IGL03344:Armc4	APN	18	7129434	nonsense	probably null
R0062:Armc4	UTSW	18	7129593	splice site	probably benign
R0062:Armc4	UTSW	18	7129593	splice site	probably benign
R0242:Armc4	UTSW	18	7211516	missense	probably damaging	0.96
R0242:Armc4	UTSW	18	7211516	missense	probably damaging	0.96
R0365:Armc4	UTSW	18	7217800	missense	probably benign	0.01
R0377:Armc4	UTSW	18	7127415	missense	probably benign	0.04
R0466:Armc4	UTSW	18	7286758	missense	probably benign	0.10
R0517:Armc4	UTSW	18	7223621	missense	probably damaging	1.00
R0521:Armc4	UTSW	18	7222676	missense	possibly damaging	0.64
R0841:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1145:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1145:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1435:Armc4	UTSW	18	7222646	missense	probably benign	0.01
R1487:Armc4	UTSW	18	7273245	missense	probably damaging	0.98
R1634:Armc4	UTSW	18	7286688	missense	probably damaging	0.99
R1677:Armc4	UTSW	18	7222554	missense	probably benign	0.01
R1778:Armc4	UTSW	18	7127388	missense	probably damaging	1.00
R1792:Armc4	UTSW	18	7286743	missense	probably benign	0.00
R1809:Armc4	UTSW	18	7211630	missense	probably benign	0.08
R1842:Armc4	UTSW	18	7223551	missense	probably benign	0.04
R2144:Armc4	UTSW	18	7127229	missense	probably damaging	0.96
R2273:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2275:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2918:Armc4	UTSW	18	7222625	missense	probably benign	0.04
R3421:Armc4	UTSW	18	7223523	splice site	probably benign
R3422:Armc4	UTSW	18	7223523	splice site	probably benign
R4165:Armc4	UTSW	18	7217008	missense	probably damaging	1.00
R4225:Armc4	UTSW	18	7181732	critical splice donor site	probably null
R4660:Armc4	UTSW	18	7211609	missense	possibly damaging	0.88
R4745:Armc4	UTSW	18	7286763	missense	probably benign	0.28
R4812:Armc4	UTSW	18	7288634	missense	possibly damaging	0.79
R4831:Armc4	UTSW	18	7222564	missense	possibly damaging	0.79
R4923:Armc4	UTSW	18	7181787	missense	probably damaging	0.97
R4995:Armc4	UTSW	18	7223663	missense	probably damaging	1.00
R5024:Armc4	UTSW	18	7088555	missense	probably benign	0.02
R5335:Armc4	UTSW	18	7294566	missense	probably benign	0.06
R5434:Armc4	UTSW	18	7222550	missense	probably benign	0.03
R5552:Armc4	UTSW	18	7285360	missense	possibly damaging	0.51
R5719:Armc4	UTSW	18	7211496	missense	probably benign	0.00
R5736:Armc4	UTSW	18	7268416	missense	probably benign	0.01
R5792:Armc4	UTSW	18	7217965	missense	probably benign	0.00
R5848:Armc4	UTSW	18	7268507	splice site	probably null
R5957:Armc4	UTSW	18	7285706	missense	probably benign	0.01
R6001:Armc4	UTSW	18	7286838	missense	probably benign	0.03
R6309:Armc4	UTSW	18	7214617	missense	probably benign	0.04
R6559:Armc4	UTSW	18	7223664	missense	probably damaging	0.99
R6574:Armc4	UTSW	18	7129394	splice site	probably null
R6581:Armc4	UTSW	18	7129560	missense	possibly damaging	0.77
R6736:Armc4	UTSW	18	7223586	missense	probably damaging	0.98
R6842:Armc4	UTSW	18	7268401	missense	probably benign	0.00
R6968:Armc4	UTSW	18	7273155	splice site	probably null
R6974:Armc4	UTSW	18	7294479	missense	probably benign	0.37
R7024:Armc4	UTSW	18	7211593	missense	probably benign	0.43
R7299:Armc4	UTSW	18	7222635	missense	probably damaging	1.00
R7578:Armc4	UTSW	18	7211593	missense	probably benign	0.43
R7737:Armc4	UTSW	18	7217890	missense	probably damaging	1.00
R7878:Armc4	UTSW	18	7217801	missense	probably benign	0.01
R8025:Armc4	UTSW	18	7127224	missense	probably benign	0.43
R8151:Armc4	UTSW	18	7127358	missense	probably damaging	1.00
Z1088:Armc4	UTSW	18	7266919	missense	probably benign
Z1176:Armc4	UTSW	18	7129487	missense	probably damaging	1.00
Z1176:Armc4	UTSW	18	7216973	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCAGCAATGACAGTGAACGAC -3'
(R):5'- ATGACACCCACTACAGCTTTTC -3'

Sequencing Primer
(F):5'- GATGTAGTAGACACCCAGAGCTTC -3'
(R):5'- ACCCACTACAGCTTTTCCATGC -3'

Posted On

2014-10-02