Incidental Mutation 'R2206:Armc4'
ID239085
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission 040208-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R2206 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7223676 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 456 (G456W)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably benign
Transcript: ENSMUST00000081275
AA Change: G456W

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: G456W

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2310057M21Rik A T 7: 131,362,602 C24S probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
Abhd18 G A 3: 40,910,573 G83D probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Adck2 A G 6: 39,583,839 D123G probably damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Axl T C 7: 25,770,636 Y466C probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9a A T 2: 154,264,241 probably null Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Cstf2t A G 19: 31,083,775 N237S probably benign Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp2 G T 2: 118,792,244 Q1152H probably benign Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dmxl1 T C 18: 49,894,094 S2090P probably benign Het
Dnajc13 C G 9: 104,203,518 V821L probably damaging Het
Dopey1 T A 9: 86,521,599 H1617Q probably benign Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Ephb4 T C 5: 137,357,719 C197R probably damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fpr3 A C 17: 17,970,646 T60P probably damaging Het
Gja4 A T 4: 127,312,617 S118T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kazn A T 4: 142,118,292 probably null Het
Mdn1 T C 4: 32,716,271 L2111P possibly damaging Het
Myo6 A G 9: 80,258,455 Y374C probably benign Het
Olfr1160 A G 2: 88,006,235 V181A probably benign Het
Olfr1451 A G 19: 12,999,040 D18G probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pcmtd1 A T 1: 7,169,583 I83L probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Prcp C T 7: 92,928,612 T328I probably damaging Het
Psg27 C A 7: 18,567,111 E6* probably null Het
Pth1r T A 9: 110,723,587 E465V probably damaging Het
Pus7l T C 15: 94,523,590 Y613C probably damaging Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Slc10a1 T C 12: 80,967,628 N106S probably damaging Het
Slc29a3 T C 10: 60,715,907 M453V possibly damaging Het
Slc4a8 T C 15: 100,807,445 V844A probably damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Tmppe C G 9: 114,405,572 P313R probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Trmt1l T C 1: 151,435,843 probably null Het
Vmn1r177 A T 7: 23,866,131 C107S probably damaging Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zbtb40 G A 4: 137,017,285 Q275* probably null Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1677:Armc4 UTSW 18 7222554 missense probably benign 0.01
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R3422:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5335:Armc4 UTSW 18 7294566 missense probably benign 0.06
R5434:Armc4 UTSW 18 7222550 missense probably benign 0.03
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5848:Armc4 UTSW 18 7268507 synonymous probably null
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6968:Armc4 UTSW 18 7273155 splice site probably null
R6974:Armc4 UTSW 18 7294479 missense probably benign 0.37
R7024:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7299:Armc4 UTSW 18 7222635 missense probably damaging 1.00
R7578:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7737:Armc4 UTSW 18 7217890 missense probably damaging 1.00
R7878:Armc4 UTSW 18 7217801 missense probably benign 0.01
R7961:Armc4 UTSW 18 7217801 missense probably benign 0.01
R8025:Armc4 UTSW 18 7127224 missense not run
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Z1176:Armc4 UTSW 18 7129487 missense not run
Z1176:Armc4 UTSW 18 7216973 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCAGCAATGACAGTGAACGAC -3'
(R):5'- ATGACACCCACTACAGCTTTTC -3'

Sequencing Primer
(F):5'- GATGTAGTAGACACCCAGAGCTTC -3'
(R):5'- ACCCACTACAGCTTTTCCATGC -3'
Posted On2014-10-02