Incidental Mutation 'R2206:Cstf2t'
ID239092
Institutional Source Beutler Lab
Gene Symbol Cstf2t
Ensembl Gene ENSMUSG00000053536
Gene Namecleavage stimulation factor, 3' pre-RNA subunit 2, tau
Synonyms64kDa, tCstF-64
MMRRC Submission 040208-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R2206 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location31082841-31086590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31083775 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 237 (N237S)
Ref Sequence ENSEMBL: ENSMUSP00000093831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000066039] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066039
AA Change: N237S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093831
Gene: ENSMUSG00000053536
AA Change: N237S

DomainStartEndE-ValueType
RRM 17 90 6.19e-29 SMART
Pfam:CSTF2_hinge 112 191 5.4e-32 PFAM
low complexity region 202 236 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 321 339 N/A INTRINSIC
low complexity region 364 379 N/A INTRINSIC
low complexity region 508 584 N/A INTRINSIC
Pfam:CSTF_C 588 628 7.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073581
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a targeted null allele are infertile due to low sperm counts, significant developmental defects in spermiogenesis, and variable abnormalities in epididymal sperm morphology and motility consistent with oligoasthenoteratozoospermia. Homozygous null females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2310057M21Rik A T 7: 131,362,602 C24S probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
Abhd18 G A 3: 40,910,573 G83D probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Adck2 A G 6: 39,583,839 D123G probably damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Axl T C 7: 25,770,636 Y466C probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9a A T 2: 154,264,241 probably null Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp2 G T 2: 118,792,244 Q1152H probably benign Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dmxl1 T C 18: 49,894,094 S2090P probably benign Het
Dnajc13 C G 9: 104,203,518 V821L probably damaging Het
Dopey1 T A 9: 86,521,599 H1617Q probably benign Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Ephb4 T C 5: 137,357,719 C197R probably damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fpr3 A C 17: 17,970,646 T60P probably damaging Het
Gja4 A T 4: 127,312,617 S118T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kazn A T 4: 142,118,292 probably null Het
Mdn1 T C 4: 32,716,271 L2111P possibly damaging Het
Myo6 A G 9: 80,258,455 Y374C probably benign Het
Olfr1160 A G 2: 88,006,235 V181A probably benign Het
Olfr1451 A G 19: 12,999,040 D18G probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pcmtd1 A T 1: 7,169,583 I83L probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Prcp C T 7: 92,928,612 T328I probably damaging Het
Psg27 C A 7: 18,567,111 E6* probably null Het
Pth1r T A 9: 110,723,587 E465V probably damaging Het
Pus7l T C 15: 94,523,590 Y613C probably damaging Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Slc10a1 T C 12: 80,967,628 N106S probably damaging Het
Slc29a3 T C 10: 60,715,907 M453V possibly damaging Het
Slc4a8 T C 15: 100,807,445 V844A probably damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Tmppe C G 9: 114,405,572 P313R probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Trmt1l T C 1: 151,435,843 probably null Het
Vmn1r177 A T 7: 23,866,131 C107S probably damaging Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zbtb40 G A 4: 137,017,285 Q275* probably null Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Other mutations in Cstf2t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Cstf2t APN 19 31084338 missense probably benign 0.00
IGL01739:Cstf2t APN 19 31083136 missense probably damaging 1.00
IGL02466:Cstf2t APN 19 31083877 missense possibly damaging 0.88
R0064:Cstf2t UTSW 19 31083299 missense probably damaging 0.99
R0099:Cstf2t UTSW 19 31083831 missense probably benign 0.00
R0197:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R0423:Cstf2t UTSW 19 31084276 missense possibly damaging 0.89
R0883:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R1753:Cstf2t UTSW 19 31083685 missense possibly damaging 0.52
R2291:Cstf2t UTSW 19 31084864 missense probably benign 0.36
R3753:Cstf2t UTSW 19 31083295 missense probably damaging 1.00
R4523:Cstf2t UTSW 19 31083082 missense possibly damaging 0.47
R4991:Cstf2t UTSW 19 31084583 missense probably damaging 0.97
R5134:Cstf2t UTSW 19 31084094 missense probably damaging 1.00
R5863:Cstf2t UTSW 19 31083077 missense probably damaging 1.00
R6081:Cstf2t UTSW 19 31083123 missense probably benign 0.10
R6573:Cstf2t UTSW 19 31083780 missense probably benign 0.00
R7408:Cstf2t UTSW 19 31083193 missense possibly damaging 0.94
R7648:Cstf2t UTSW 19 31083592 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCTACTTCAGAACCCACAG -3'
(R):5'- CCTGGAGTTAAGGAACCAGGTC -3'

Sequencing Primer
(F):5'- TCAGAACCCACAGTTGGCGTATG -3'
(R):5'- TTAAGGAACCAGGTCCAGGTCC -3'
Posted On2014-10-02