Mutagenetix > Incidental Mutation

Incidental Mutation 'R2206:Sorcs1'

239093

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

040208-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R2206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50143299-50678646 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50230217 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 609 (H609R)

Ref Sequence

ENSEMBL: ENSMUSP00000107386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072685
AA Change: H609R

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: H609R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111756
AA Change: H609R

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: H609R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164039
AA Change: H609R

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: H609R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168357

SMART Domains

Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
VPS10	1	320	6.99e-58	SMART
PKD	322	412	3.84e-1	SMART
PKD	420	498	8.63e-1	SMART
transmembrane domain	621	643	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209413
AA Change: H609R

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000209783
AA Change: H609R

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211008
AA Change: H609R

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211687
AA Change: H609R

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,106	V300A	probably benign	Het
2310057M21Rik	A	T	7: 131,362,602	C24S	probably benign	Het
2410137M14Rik	A	G	17: 36,978,073		probably benign	Het
Abhd18	G	A	3: 40,910,573	G83D	probably benign	Het
Adam34	T	C	8: 43,652,237	I124V	probably benign	Het
Adck2	A	G	6: 39,583,839	D123G	probably damaging	Het
Arhgef2	A	G	3: 88,629,914	E37G	probably damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Axl	T	C	7: 25,770,636	Y466C	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9a	A	T	2: 154,264,241		probably null	Het
Brip1	A	G	11: 86,061,877	V1026A	probably benign	Het
Cacna1h	A	T	17: 25,385,013	S1282T	probably benign	Het
Calcr	T	C	6: 3,717,133	Y109C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cst13	A	T	2: 148,823,282	R66W	probably damaging	Het
Cstf2t	A	G	19: 31,083,775	N237S	probably benign	Het
Dhx8	A	G	11: 101,750,971	T632A	probably benign	Het
Disp2	G	T	2: 118,792,244	Q1152H	probably benign	Het
Dlg1	A	G	16: 31,853,846	H599R	probably benign	Het
Dmxl1	T	C	18: 49,894,094	S2090P	probably benign	Het
Dnajc13	C	G	9: 104,203,518	V821L	probably damaging	Het
Dopey1	T	A	9: 86,521,599	H1617Q	probably benign	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Ephb4	T	C	5: 137,357,719	C197R	probably damaging	Het
Foxn1	C	A	11: 78,358,804	A632S	probably benign	Het
Fpr3	A	C	17: 17,970,646	T60P	probably damaging	Het
Gja4	A	T	4: 127,312,617	S118T	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itfg1	A	T	8: 85,776,198	S246R	probably benign	Het
Kazn	A	T	4: 142,118,292		probably null	Het
Mdn1	T	C	4: 32,716,271	L2111P	possibly damaging	Het
Myo6	A	G	9: 80,258,455	Y374C	probably benign	Het
Olfr1160	A	G	2: 88,006,235	V181A	probably benign	Het
Olfr1451	A	G	19: 12,999,040	D18G	probably benign	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr403	G	T	11: 74,196,324	V274L	possibly damaging	Het
Pcdhb15	A	T	18: 37,475,022	T436S	probably benign	Het
Pcdhb18	T	A	18: 37,491,289	N557K	probably damaging	Het
Pcdhb6	T	C	18: 37,335,580	M518T	probably benign	Het
Pcmtd1	A	T	1: 7,169,583	I83L	probably benign	Het
Pitrm1	T	A	13: 6,569,291	Y721N	probably damaging	Het
Prcp	C	T	7: 92,928,612	T328I	probably damaging	Het
Psg27	C	A	7: 18,567,111	E6*	probably null	Het
Pth1r	T	A	9: 110,723,587	E465V	probably damaging	Het
Pus7l	T	C	15: 94,523,590	Y613C	probably damaging	Het
Rsl1	A	G	13: 67,182,828	T447A	probably benign	Het
Setd3	C	T	12: 108,107,285	V578M	probably benign	Het
Slc10a1	T	C	12: 80,967,628	N106S	probably damaging	Het
Slc29a3	T	C	10: 60,715,907	M453V	possibly damaging	Het
Slc4a8	T	C	15: 100,807,445	V844A	probably damaging	Het
Tmppe	C	G	9: 114,405,572	P313R	probably benign	Het
Tnxb	A	C	17: 34,709,417	T2602P	possibly damaging	Het
Trip11	T	C	12: 101,873,442	N1643S	probably benign	Het
Trmt1l	T	C	1: 151,435,843		probably null	Het
Vmn1r177	A	T	7: 23,866,131	C107S	probably damaging	Het
Vmn1r225	A	G	17: 20,502,349	I17M	possibly damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Wdr7	T	A	18: 63,777,607	V690E	possibly damaging	Het
Xaf1	A	T	11: 72,303,402	E36D	possibly damaging	Het
Zbtb40	G	A	4: 137,017,285	Q275*	probably null	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50190054	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50176128	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50228201	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50288079	splice site	probably benign
IGL01445:Sorcs1	APN	19	50153066	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50181506	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50230209	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50288159	splice site	probably benign
IGL02111:Sorcs1	APN	19	50230245	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50333598	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50182671	nonsense	probably null
IGL02498:Sorcs1	APN	19	50678168	missense	probably benign
IGL02658:Sorcs1	APN	19	50190092	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50677930	nonsense	probably null
IGL02942:Sorcs1	APN	19	50475437	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50259756	nonsense	probably null
IGL03230:Sorcs1	APN	19	50242093	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50152907	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50378891	splice site	probably benign
R0115:Sorcs1	UTSW	19	50636453	intron	probably benign
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50313042	splice site	probably null
R0481:Sorcs1	UTSW	19	50636453	intron	probably benign
R0581:Sorcs1	UTSW	19	50252701	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50241942	splice site	probably benign
R0980:Sorcs1	UTSW	19	50232323	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50144160	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50252587	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50475422	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50175043	splice site	probably benign
R1783:Sorcs1	UTSW	19	50228309	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50222195	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50678192	missense	probably benign
R2207:Sorcs1	UTSW	19	50230217	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50210650	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50151221	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50222159	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50190161	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50378941	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50312964	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50182669	missense	probably benign
R4780:Sorcs1	UTSW	19	50143981	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50182681	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50678140	missense	possibly damaging	0.92
R4823:Sorcs1	UTSW	19	50230302	missense	possibly damaging	0.87
R4883:Sorcs1	UTSW	19	50232303	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50259752	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50225141	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50252602	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50222133	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50182775	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50190117	nonsense	probably null
R6091:Sorcs1	UTSW	19	50288101	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50288094	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50181414	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50144124	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50225177	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50176122	nonsense	probably null
R6792:Sorcs1	UTSW	19	50678168	missense	probably benign
R6891:Sorcs1	UTSW	19	50225119	nonsense	probably null
R7151:Sorcs1	UTSW	19	50312982	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50190042	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50175157	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50262263	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50153112	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50153052	missense	probably benign
R7506:Sorcs1	UTSW	19	50182674	nonsense	probably null
R7573:Sorcs1	UTSW	19	50152796	nonsense	probably null
R7867:Sorcs1	UTSW	19	50230260	nonsense	probably null
R7911:Sorcs1	UTSW	19	50144032	missense	unknown
R8032:Sorcs1	UTSW	19	50475408	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50143977	missense	unknown
R8463:Sorcs1	UTSW	19	50259810	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50378960	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50151220	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50252658	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50225220	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50232315	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50262295	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50152862	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50225213	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50210770	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50678083	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50678083	missense	probably benign	0.04
X0024:Sorcs1	UTSW	19	50182763	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50222143	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50226742	missense	probably null	1.00
Z1177:Sorcs1	UTSW	19	50333599	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCATAATGCAGTTGTCCTG -3'
(R):5'- GCTTACATTTTCTCAAAGACTTAGGGG -3'

Sequencing Primer
(F):5'- TCCTGTTAGGAGCAGAAACACTTAC -3'
(R):5'- GTGCACCTTGAACACCAA -3'

Posted On

2014-10-02