Incidental Mutation 'R0184:Ilkap'
Institutional Source Beutler Lab
Gene Symbol Ilkap
Ensembl Gene ENSMUSG00000026309
Gene Nameintegrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms1600009O09Rik, 0710007A14Rik, PP2C-DELTA
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R0184 (G1)
Quality Score225
Status Not validated
Chromosomal Location91373861-91398815 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 91376305 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027534] [ENSMUST00000086861] [ENSMUST00000187306] [ENSMUST00000187678] [ENSMUST00000190747]
Predicted Effect probably benign
Transcript: ENSMUST00000027534
SMART Domains Protein: ENSMUSP00000027534
Gene: ENSMUSG00000026309

Blast:PP2C_SIG 26 64 4e-12 BLAST
PP2Cc 94 388 4.47e-93 SMART
PP2C_SIG 128 390 9.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086861
SMART Domains Protein: ENSMUSP00000084073
Gene: ENSMUSG00000047443

signal peptide 1 26 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
low complexity region 85 113 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
Blast:TNF 200 337 3e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185886
Predicted Effect probably benign
Transcript: ENSMUST00000187049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187105
Predicted Effect unknown
Transcript: ENSMUST00000187231
AA Change: R145G
Predicted Effect probably benign
Transcript: ENSMUST00000187306
SMART Domains Protein: ENSMUSP00000139834
Gene: ENSMUSG00000026309

Blast:PP2Cc 7 73 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187678
Predicted Effect probably benign
Transcript: ENSMUST00000190747
SMART Domains Protein: ENSMUSP00000140905
Gene: ENSMUSG00000026309

PP2Cc 1 164 7.3e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191230
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null gene trap insertion exhibit enhanced motor coordination, and male homozygous mice exhibit increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Ilkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Ilkap APN 1 91385238 critical splice donor site probably null
PIT4445001:Ilkap UTSW 1 91385345 missense probably benign
R0782:Ilkap UTSW 1 91378550 missense probably damaging 1.00
R1366:Ilkap UTSW 1 91387215 missense possibly damaging 0.58
R1552:Ilkap UTSW 1 91384594 missense probably damaging 1.00
R2155:Ilkap UTSW 1 91384623 missense possibly damaging 0.65
R3946:Ilkap UTSW 1 91387250 missense probably damaging 1.00
R4005:Ilkap UTSW 1 91385263 missense probably benign 0.03
R4860:Ilkap UTSW 1 91387383 unclassified probably benign
R5666:Ilkap UTSW 1 91391141 missense probably benign 0.38
R5670:Ilkap UTSW 1 91391141 missense probably benign 0.38
R7324:Ilkap UTSW 1 91385393 splice site probably null
R8493:Ilkap UTSW 1 91378544 missense probably damaging 1.00
R8548:Ilkap UTSW 1 91391160 missense possibly damaging 0.81
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- aatgacccctctctacctcc -3'
Posted On2013-04-16