Incidental Mutation 'R0184:Thsd7b'
ID 23913
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Name thrombospondin, type I, domain containing 7B
Synonyms 1700074E13Rik, D130067I03Rik
MMRRC Submission 038449-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R0184 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 129201039-130147015 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129358701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 45 (K45R)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040311] [ENSMUST00000073527]
AlphaFold Q6P4U0
Predicted Effect probably benign
Transcript: ENSMUST00000040311
AA Change: K45R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041716
Gene: ENSMUSG00000042581
AA Change: K45R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 3e-29 BLAST
Blast:TSP1 122 177 7e-24 BLAST
TSP1 182 233 2.47e-9 SMART
Blast:TSP1 290 338 1e-20 BLAST
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 1e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 4e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1051 1.15e-4 SMART
transmembrane domain 1070 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073527
AA Change: K45R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: K45R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148051
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,212,899 (GRCm39) V131F probably damaging Het
Adam28 T C 14: 68,874,822 (GRCm39) D285G probably benign Het
Akr1c13 A G 13: 4,244,055 (GRCm39) E36G probably damaging Het
Antxr2 A G 5: 98,127,889 (GRCm39) L214S probably damaging Het
Arhgap26 T A 18: 38,750,726 (GRCm39) D46E unknown Het
Armc9 T C 1: 86,126,092 (GRCm39) L61P probably damaging Het
Bicc1 C A 10: 70,915,045 (GRCm39) R73L probably benign Het
Calm2 T C 17: 87,743,269 (GRCm39) N43S probably benign Het
Cct7 A G 6: 85,438,536 (GRCm39) D105G probably null Het
Cdk18 T C 1: 132,046,276 (GRCm39) N215D probably benign Het
Cep126 T C 9: 8,103,396 (GRCm39) T205A probably benign Het
Cfap57 A T 4: 118,456,209 (GRCm39) I495N probably damaging Het
Cyp2b9 T A 7: 25,886,432 (GRCm39) C152* probably null Het
Dab2ip G A 2: 35,608,803 (GRCm39) R579H probably damaging Het
Dnah8 T C 17: 30,902,657 (GRCm39) V905A probably benign Het
Eif4h C A 5: 134,654,229 (GRCm39) D134Y possibly damaging Het
Espl1 T A 15: 102,207,651 (GRCm39) S372T probably benign Het
Fat2 T A 11: 55,187,114 (GRCm39) H1244L probably damaging Het
Fbxo11 T A 17: 88,316,101 (GRCm39) N443I probably benign Het
Git2 G A 5: 114,877,098 (GRCm39) T128M possibly damaging Het
Gm10985 T A 3: 53,752,679 (GRCm39) Y21N probably damaging Het
Gm12790 A T 4: 101,824,811 (GRCm39) Y152* probably null Het
Heatr5a T C 12: 51,956,752 (GRCm39) D1115G probably benign Het
Hipk2 T C 6: 38,695,866 (GRCm39) N726S possibly damaging Het
Hrg T C 16: 22,772,521 (GRCm39) probably null Het
Iars1 T G 13: 49,875,688 (GRCm39) S792A probably benign Het
Igf1r A G 7: 67,875,941 (GRCm39) N1301S possibly damaging Het
Il22 A T 10: 118,041,511 (GRCm39) I75F probably damaging Het
Ilkap T C 1: 91,304,027 (GRCm39) probably benign Het
Ints13 A T 6: 146,456,542 (GRCm39) Y435N probably benign Het
Ints8 A C 4: 11,218,637 (GRCm39) S797A probably benign Het
Itgad T A 7: 127,788,403 (GRCm39) D405E probably benign Het
Itgam A T 7: 127,685,230 (GRCm39) I448F probably damaging Het
Klk1 C T 7: 43,878,173 (GRCm39) T41I possibly damaging Het
Mcrip1 T C 11: 120,435,710 (GRCm39) M1V probably null Het
Mdga1 A G 17: 30,071,416 (GRCm39) Y128H probably damaging Het
Mtor G T 4: 148,549,428 (GRCm39) R604L probably benign Het
Or52p1 T C 7: 104,267,447 (GRCm39) V187A probably damaging Het
Or5d41 A T 2: 88,055,124 (GRCm39) L84* probably null Het
Pcdhb7 T A 18: 37,476,443 (GRCm39) D526E probably benign Het
Pip4k2a T C 2: 18,893,939 (GRCm39) D139G probably damaging Het
Pkp3 A C 7: 140,668,280 (GRCm39) N536T probably benign Het
Pla2g4c T A 7: 13,090,145 (GRCm39) S524T probably benign Het
Pno1 T C 11: 17,161,127 (GRCm39) E69G probably benign Het
Pold1 C T 7: 44,191,139 (GRCm39) V231M probably benign Het
Poli A G 18: 70,655,802 (GRCm39) S248P probably damaging Het
Ppox C T 1: 171,107,126 (GRCm39) S138N probably damaging Het
Psg20 T C 7: 18,419,901 (GRCm39) E6G probably null Het
Rbmx C T X: 56,436,926 (GRCm39) probably null Het
Rln1 T A 19: 29,309,336 (GRCm39) K148* probably null Het
Rnf213 C T 11: 119,305,347 (GRCm39) T526I probably damaging Het
Rps6kc1 A T 1: 190,531,290 (GRCm39) V904E probably null Het
Sf3b2 T A 19: 5,333,700 (GRCm39) I633F probably damaging Het
Sfswap T A 5: 129,584,253 (GRCm39) I189N probably damaging Het
Smarca2 T A 19: 26,669,649 (GRCm39) Y973* probably null Het
Spink5 G A 18: 44,136,265 (GRCm39) D559N probably benign Het
Spty2d1 C T 7: 46,647,322 (GRCm39) V536I possibly damaging Het
Tbx3 T C 5: 119,813,627 (GRCm39) I221T probably damaging Het
Tcf20 T A 15: 82,736,501 (GRCm39) D1650V probably damaging Het
Tirap A G 9: 35,100,490 (GRCm39) S65P probably benign Het
Trim25 C T 11: 88,890,466 (GRCm39) P51L probably damaging Het
Trim61 T C 8: 65,467,069 (GRCm39) N64S probably benign Het
Twf1 T A 15: 94,478,948 (GRCm39) probably null Het
Ubr4 A C 4: 139,172,573 (GRCm39) T1692P probably damaging Het
Usp3 A G 9: 66,469,863 (GRCm39) M86T probably damaging Het
Utrn T C 10: 12,543,362 (GRCm39) D1762G probably benign Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Vmn2r52 T C 7: 9,893,265 (GRCm39) S625G probably damaging Het
Vmn2r90 G A 17: 17,947,139 (GRCm39) W472* probably null Het
Vrk2 C A 11: 26,500,046 (GRCm39) A56S probably damaging Het
Yeats2 C T 16: 20,022,435 (GRCm39) P620S possibly damaging Het
Zbtb21 C T 16: 97,751,713 (GRCm39) D171N probably damaging Het
Zeb1 A T 18: 5,766,808 (GRCm39) I440F probably damaging Het
Zfp292 A G 4: 34,819,563 (GRCm39) I253T probably damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129,523,571 (GRCm39) missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130,092,814 (GRCm39) missense probably benign 0.00
IGL00987:Thsd7b APN 1 129,541,016 (GRCm39) missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129,523,883 (GRCm39) missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129,704,071 (GRCm39) missense probably benign 0.29
IGL01535:Thsd7b APN 1 129,605,954 (GRCm39) missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130,145,918 (GRCm39) utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129,358,665 (GRCm39) missense probably benign 0.07
IGL01775:Thsd7b APN 1 129,556,676 (GRCm39) missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129,744,419 (GRCm39) missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129,523,508 (GRCm39) missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130,087,369 (GRCm39) missense probably benign 0.01
IGL02404:Thsd7b APN 1 129,540,888 (GRCm39) missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129,540,932 (GRCm39) missense probably benign 0.22
IGL02543:Thsd7b APN 1 130,092,840 (GRCm39) missense probably benign 0.03
IGL02740:Thsd7b APN 1 129,540,864 (GRCm39) missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129,843,352 (GRCm39) missense probably benign 0.01
IGL03108:Thsd7b APN 1 130,138,013 (GRCm39) missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130,116,288 (GRCm39) missense probably benign 0.00
IGL03195:Thsd7b APN 1 129,556,646 (GRCm39) missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129,688,092 (GRCm39) missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129,523,901 (GRCm39) missense probably benign 0.17
IGL03399:Thsd7b APN 1 129,556,622 (GRCm39) missense probably damaging 1.00
R0277:Thsd7b UTSW 1 130,123,000 (GRCm39) missense probably benign 0.00
R0526:Thsd7b UTSW 1 129,879,129 (GRCm39) missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130,116,263 (GRCm39) missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130,116,268 (GRCm39) missense probably benign 0.00
R0784:Thsd7b UTSW 1 129,523,096 (GRCm39) splice site probably benign
R1158:Thsd7b UTSW 1 130,117,672 (GRCm39) splice site probably null
R1267:Thsd7b UTSW 1 129,556,577 (GRCm39) splice site probably null
R1375:Thsd7b UTSW 1 130,087,423 (GRCm39) missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129,523,778 (GRCm39) missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1728:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1728:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1728:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1729:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1729:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1730:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1730:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1739:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1739:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1762:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1762:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 130,030,813 (GRCm39) missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1783:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1783:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1784:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1784:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1785:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1785:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1812:Thsd7b UTSW 1 129,686,347 (GRCm39) missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129,540,993 (GRCm39) missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129,605,846 (GRCm39) missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129,686,188 (GRCm39) nonsense probably null
R2199:Thsd7b UTSW 1 130,145,895 (GRCm39) missense probably benign 0.04
R2483:Thsd7b UTSW 1 130,030,809 (GRCm39) missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130,117,587 (GRCm39) splice site probably benign
R2935:Thsd7b UTSW 1 129,605,824 (GRCm39) missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 129,977,599 (GRCm39) missense probably benign 0.23
R3236:Thsd7b UTSW 1 130,145,855 (GRCm39) nonsense probably null
R3745:Thsd7b UTSW 1 129,605,978 (GRCm39) missense probably benign 0.04
R3877:Thsd7b UTSW 1 130,117,919 (GRCm39) missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129,523,107 (GRCm39) missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4112:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4255:Thsd7b UTSW 1 129,688,024 (GRCm39) missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129,358,652 (GRCm39) missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 129,977,646 (GRCm39) intron probably benign
R4732:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130,138,001 (GRCm39) missense probably benign 0.01
R4805:Thsd7b UTSW 1 130,116,276 (GRCm39) missense probably benign 0.04
R4840:Thsd7b UTSW 1 129,523,581 (GRCm39) missense probably benign 0.00
R4879:Thsd7b UTSW 1 130,116,236 (GRCm39) missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129,605,882 (GRCm39) missense probably benign 0.00
R4972:Thsd7b UTSW 1 130,116,309 (GRCm39) missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129,605,980 (GRCm39) nonsense probably null
R5422:Thsd7b UTSW 1 129,849,071 (GRCm39) missense probably benign 0.41
R5495:Thsd7b UTSW 1 129,523,570 (GRCm39) missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129,523,578 (GRCm39) missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130,090,673 (GRCm39) critical splice donor site probably null
R5638:Thsd7b UTSW 1 129,523,270 (GRCm39) missense probably benign 0.00
R5640:Thsd7b UTSW 1 130,044,408 (GRCm39) nonsense probably null
R5655:Thsd7b UTSW 1 129,556,671 (GRCm39) splice site probably null
R5711:Thsd7b UTSW 1 129,688,139 (GRCm39) missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129,605,821 (GRCm39) missense probably benign 0.00
R5888:Thsd7b UTSW 1 130,138,057 (GRCm39) nonsense probably null
R5932:Thsd7b UTSW 1 129,358,575 (GRCm39) missense probably benign
R6243:Thsd7b UTSW 1 130,090,599 (GRCm39) missense probably benign 0.21
R6258:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6260:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6399:Thsd7b UTSW 1 129,744,385 (GRCm39) missense probably benign 0.13
R6437:Thsd7b UTSW 1 129,744,419 (GRCm39) missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130,087,451 (GRCm39) splice site probably null
R6785:Thsd7b UTSW 1 129,358,644 (GRCm39) missense probably damaging 0.99
R7304:Thsd7b UTSW 1 130,030,890 (GRCm39) missense probably benign 0.01
R7334:Thsd7b UTSW 1 130,123,012 (GRCm39) missense probably benign 0.00
R7414:Thsd7b UTSW 1 129,556,717 (GRCm39) missense probably damaging 0.99
R7673:Thsd7b UTSW 1 129,843,487 (GRCm39) splice site probably null
R7683:Thsd7b UTSW 1 129,523,683 (GRCm39) missense probably damaging 0.99
R7861:Thsd7b UTSW 1 130,087,435 (GRCm39) missense probably benign 0.00
R8145:Thsd7b UTSW 1 129,688,036 (GRCm39) missense probably damaging 1.00
R8241:Thsd7b UTSW 1 130,117,688 (GRCm39) missense probably damaging 1.00
R8296:Thsd7b UTSW 1 129,523,193 (GRCm39) missense probably benign 0.01
R8355:Thsd7b UTSW 1 129,523,616 (GRCm39) missense probably damaging 1.00
R8507:Thsd7b UTSW 1 129,605,790 (GRCm39) missense probably benign 0.21
R8520:Thsd7b UTSW 1 129,849,157 (GRCm39) missense probably benign 0.07
R8555:Thsd7b UTSW 1 129,523,191 (GRCm39) missense probably damaging 1.00
R8682:Thsd7b UTSW 1 129,688,011 (GRCm39) nonsense probably null
R8981:Thsd7b UTSW 1 129,523,187 (GRCm39) missense possibly damaging 0.88
R9029:Thsd7b UTSW 1 130,087,426 (GRCm39) missense probably damaging 1.00
R9133:Thsd7b UTSW 1 129,843,382 (GRCm39) missense probably benign 0.18
R9194:Thsd7b UTSW 1 129,843,371 (GRCm39) missense possibly damaging 0.78
R9229:Thsd7b UTSW 1 129,849,027 (GRCm39) missense probably damaging 1.00
R9239:Thsd7b UTSW 1 130,087,453 (GRCm39) critical splice donor site probably null
R9460:Thsd7b UTSW 1 130,090,674 (GRCm39) critical splice donor site probably null
R9466:Thsd7b UTSW 1 130,122,866 (GRCm39) missense probably benign
R9588:Thsd7b UTSW 1 130,108,223 (GRCm39) missense probably damaging 1.00
X0027:Thsd7b UTSW 1 129,523,809 (GRCm39) missense probably benign 0.00
Z1176:Thsd7b UTSW 1 129,556,648 (GRCm39) missense probably benign 0.17
Z1176:Thsd7b UTSW 1 129,523,397 (GRCm39) missense probably benign 0.01
Z1176:Thsd7b UTSW 1 129,523,253 (GRCm39) missense probably damaging 0.98
Z1176:Thsd7b UTSW 1 130,108,161 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCTTTCAGGATTAGGCAAGTGAAGAG -3'
(R):5'- CATTGGCATGGATGGCAATTAAGCAG -3'

Sequencing Primer
(F):5'- GCTGAAAAATCTGAAGAATGTTTCTG -3'
(R):5'- cacacacacacacacacac -3'
Posted On 2013-04-16