Incidental Mutation 'R2207:Rsf1'
ID 239138
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Name remodeling and spacing factor 1
Synonyms 4832420A03Rik, Hbxap, C030033M12Rik, XAP8, p325
MMRRC Submission 040209-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2207 (G1)
Quality Score 134
Status Not validated
Chromosome 7
Chromosomal Location 97229103-97341989 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCG to GCGACG at 97229114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000154779] [ENSMUST00000154853] [ENSMUST00000151840] [ENSMUST00000138060] [ENSMUST00000146605] [ENSMUST00000178078] [ENSMUST00000144858]
AlphaFold E9PWW9
Predicted Effect unknown
Transcript: ENSMUST00000042399
SMART Domains Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:WHIM1 103 153 9.3e-11 PFAM
Pfam:WHIM2 155 187 7.2e-10 PFAM
low complexity region 236 246 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
low complexity region 860 874 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
PHD 896 942 1.57e-11 SMART
low complexity region 960 974 N/A INTRINSIC
low complexity region 986 1008 N/A INTRINSIC
low complexity region 1026 1045 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
low complexity region 1125 1143 N/A INTRINSIC
low complexity region 1148 1167 N/A INTRINSIC
low complexity region 1175 1205 N/A INTRINSIC
low complexity region 1207 1213 N/A INTRINSIC
low complexity region 1249 1263 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 37,288,965 (GRCm39) probably benign Het
Abcb1b C T 5: 8,874,803 (GRCm39) R488C probably benign Het
Adam34 T C 8: 44,105,274 (GRCm39) I124V probably benign Het
Aicda T A 6: 122,538,244 (GRCm39) V134D possibly damaging Het
Akt2 T A 7: 27,336,625 (GRCm39) probably null Het
Aldh1a3 T C 7: 66,055,769 (GRCm39) R341G probably damaging Het
Ankrd12 G T 17: 66,338,569 (GRCm39) probably null Het
Anxa11 A G 14: 25,874,721 (GRCm39) Y244C probably damaging Het
Atp2c2 G A 8: 120,475,048 (GRCm39) R551Q probably damaging Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Bcl11a G T 11: 24,113,343 (GRCm39) G229W probably damaging Het
Brip1 A G 11: 85,952,703 (GRCm39) V1026A probably benign Het
Cacna1h A T 17: 25,603,987 (GRCm39) S1282T probably benign Het
Calcr T C 6: 3,717,133 (GRCm39) Y109C probably damaging Het
Ccdc39 T C 3: 33,890,882 (GRCm39) I241V probably damaging Het
Ccdc9 A G 7: 16,018,194 (GRCm39) probably benign Het
Cdk17 G A 10: 93,064,624 (GRCm39) D298N probably damaging Het
Cdkl3 A G 11: 51,918,020 (GRCm39) *354W probably null Het
Celf6 A T 9: 59,511,610 (GRCm39) Y401F possibly damaging Het
Clec4a4 C T 6: 122,990,766 (GRCm39) L169F probably damaging Het
Col14a1 T C 15: 55,327,082 (GRCm39) F1411L unknown Het
Col4a2 G T 8: 11,493,352 (GRCm39) G1354W probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Cst13 A T 2: 148,665,202 (GRCm39) R66W probably damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dhx8 A G 11: 101,641,797 (GRCm39) T632A probably benign Het
Disp1 A G 1: 182,869,906 (GRCm39) F838S possibly damaging Het
Dlg1 A G 16: 31,672,664 (GRCm39) H599R probably benign Het
Dnah12 T A 14: 26,503,744 (GRCm39) V1654E probably damaging Het
Dnah5 C T 15: 28,343,817 (GRCm39) L2406F probably benign Het
Fam98b C G 2: 117,098,300 (GRCm39) R257G probably damaging Het
Fbn2 A T 18: 58,214,471 (GRCm39) C900* probably null Het
Fgf1 A G 18: 38,980,138 (GRCm39) Y79H possibly damaging Het
Foxn1 C A 11: 78,249,630 (GRCm39) A632S probably benign Het
Fsip2 T G 2: 82,807,823 (GRCm39) S1381A probably benign Het
Gtf2b G A 3: 142,484,081 (GRCm39) G85D probably benign Het
Gyg1 C A 3: 20,204,703 (GRCm39) G161C probably damaging Het
Hemgn G T 4: 46,396,301 (GRCm39) L312I possibly damaging Het
Hic2 T C 16: 17,075,324 (GRCm39) M51T possibly damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hpx C T 7: 105,241,633 (GRCm39) R287H probably damaging Het
Igf2bp3 C T 6: 49,065,488 (GRCm39) G468E possibly damaging Het
Il5ra C A 6: 106,689,402 (GRCm39) E397* probably null Het
Itfg1 A T 8: 86,502,827 (GRCm39) S246R probably benign Het
Kdm2a A T 19: 4,412,898 (GRCm39) D29E probably damaging Het
Lamc2 T G 1: 153,009,452 (GRCm39) E784D possibly damaging Het
Lrp2 A T 2: 69,297,372 (GRCm39) N3196K possibly damaging Het
Lyzl1 T A 18: 4,181,962 (GRCm39) C96* probably null Het
Maf1 A G 15: 76,236,718 (GRCm39) T17A probably benign Het
Map1b T C 13: 99,567,591 (GRCm39) D1710G unknown Het
Megf8 C T 7: 25,049,222 (GRCm39) T1773I probably damaging Het
Mei1 T C 15: 81,987,450 (GRCm39) M414T probably benign Het
Myo15a A G 11: 60,396,860 (GRCm39) N2643S probably benign Het
Ndufa9 A G 6: 126,821,772 (GRCm39) Y64H probably damaging Het
Neb A T 2: 52,101,579 (GRCm39) L4354* probably null Het
Nom1 T A 5: 29,644,972 (GRCm39) I480N probably damaging Het
Nrxn3 C T 12: 89,315,082 (GRCm39) T331M probably damaging Het
Or1a1 G T 11: 74,087,150 (GRCm39) V274L possibly damaging Het
Or1j16 G T 2: 36,530,201 (GRCm39) R50M possibly damaging Het
Or4f14b A C 2: 111,775,270 (GRCm39) F177C probably damaging Het
Or51a42 A G 7: 103,708,612 (GRCm39) S66P probably damaging Het
Pcdhb15 A T 18: 37,608,075 (GRCm39) T436S probably benign Het
Pcdhb18 T A 18: 37,624,342 (GRCm39) N557K probably damaging Het
Pcdhb6 T C 18: 37,468,633 (GRCm39) M518T probably benign Het
Pgm2l1 T A 7: 99,917,319 (GRCm39) probably null Het
Pih1d2 C A 9: 50,532,379 (GRCm39) H162N probably benign Het
Pitrm1 T A 13: 6,619,327 (GRCm39) Y721N probably damaging Het
Pla2r1 C A 2: 60,288,779 (GRCm39) V618F probably damaging Het
Plb1 T C 5: 32,473,984 (GRCm39) S599P possibly damaging Het
Prkg1 T C 19: 30,556,260 (GRCm39) D562G probably damaging Het
Proser1 T G 3: 53,385,812 (GRCm39) S565A probably benign Het
Prx T A 7: 27,216,213 (GRCm39) V238E probably damaging Het
Psapl1 T C 5: 36,362,509 (GRCm39) I367T probably damaging Het
Rc3h1 T C 1: 160,767,595 (GRCm39) V128A probably damaging Het
Rrm1 T A 7: 102,091,233 (GRCm39) M1K probably null Het
Rsl1 A G 13: 67,330,892 (GRCm39) T447A probably benign Het
Ryr2 A G 13: 11,825,823 (GRCm39) S552P probably damaging Het
Sbf1 A G 15: 89,190,896 (GRCm39) S225P possibly damaging Het
Serpina3c T A 12: 104,117,757 (GRCm39) I194F probably benign Het
Setd3 C T 12: 108,073,544 (GRCm39) V578M probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc6a1 T A 6: 114,285,632 (GRCm39) V356E probably damaging Het
Slfn1 A G 11: 83,011,992 (GRCm39) E36G possibly damaging Het
Sorcs1 T C 19: 50,218,655 (GRCm39) H609R possibly damaging Het
Spag16 A G 1: 70,764,043 (GRCm39) H621R probably benign Het
Spata31d1e A G 13: 59,890,920 (GRCm39) V300A probably benign Het
Tg G A 15: 66,553,788 (GRCm39) G401D probably benign Het
Tnxb A C 17: 34,928,391 (GRCm39) T2602P possibly damaging Het
Trip11 T C 12: 101,839,701 (GRCm39) N1643S probably benign Het
Ttn G A 2: 76,709,687 (GRCm39) R1581* probably null Het
Ttn A T 2: 76,796,155 (GRCm39) I590K probably benign Het
Vmn1r225 A G 17: 20,722,611 (GRCm39) I17M possibly damaging Het
Vmn1r232 A G 17: 21,134,465 (GRCm39) L45P probably benign Het
Wdr7 T A 18: 63,910,678 (GRCm39) V690E possibly damaging Het
Xaf1 A T 11: 72,194,228 (GRCm39) E36D possibly damaging Het
Zfp131 A T 13: 120,237,348 (GRCm39) F303I probably damaging Het
Zfp513 T G 5: 31,357,767 (GRCm39) K202T probably damaging Het
Zfp788 A T 7: 41,299,064 (GRCm39) I567F probably damaging Het
Zfyve26 A G 12: 79,292,861 (GRCm39) V2096A probably damaging Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97,331,096 (GRCm39) critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97,334,791 (GRCm39) missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97,313,977 (GRCm39) critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97,310,782 (GRCm39) missense probably benign 0.00
IGL02487:Rsf1 APN 7 97,288,698 (GRCm39) missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97,310,434 (GRCm39) missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97,310,533 (GRCm39) missense probably benign 0.35
IGL03176:Rsf1 APN 7 97,328,357 (GRCm39) splice site probably benign
IGL03256:Rsf1 APN 7 97,328,211 (GRCm39) missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
BB014:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
BB018:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
FR4976:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
G1Funyon:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
P0023:Rsf1 UTSW 7 97,311,478 (GRCm39) missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97,285,614 (GRCm39) missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97,229,112 (GRCm39) unclassified probably benign
R0392:Rsf1 UTSW 7 97,328,212 (GRCm39) missense probably benign 0.00
R0422:Rsf1 UTSW 7 97,330,024 (GRCm39) missense probably benign 0.04
R0584:Rsf1 UTSW 7 97,311,335 (GRCm39) missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97,311,226 (GRCm39) missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97,328,234 (GRCm39) missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97,229,174 (GRCm39) missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97,318,985 (GRCm39) missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1498:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1525:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1534:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1582:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1591:Rsf1 UTSW 7 97,288,520 (GRCm39) nonsense probably null
R1676:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1695:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1710:Rsf1 UTSW 7 97,311,556 (GRCm39) missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1764:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1823:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1864:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1884:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1897:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1915:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1928:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1958:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1996:Rsf1 UTSW 7 97,313,839 (GRCm39) missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2021:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2022:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R2046:Rsf1 UTSW 7 97,310,884 (GRCm39) missense probably benign 0.00
R2048:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2093:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2103:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2137:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2167:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2179:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2191:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2211:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2241:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2264:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2283:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2297:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2307:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2419:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2442:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2696:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R2764:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2939:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2965:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2972:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3008:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3013:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3026:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3110:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3147:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R3427:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3610:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R3624:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3753:Rsf1 UTSW 7 97,311,359 (GRCm39) missense probably benign 0.00
R3759:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3780:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3794:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3889:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R3925:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3964:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4037:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4084:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4240:Rsf1 UTSW 7 97,229,142 (GRCm39) unclassified probably benign
R4303:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R4383:Rsf1 UTSW 7 97,334,683 (GRCm39) missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4525:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R4530:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4543:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4632:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4633:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4652:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4675:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R4675:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R4677:Rsf1 UTSW 7 97,329,980 (GRCm39) missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4769:Rsf1 UTSW 7 97,325,429 (GRCm39) missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4820:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4917:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4979:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R5041:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R5125:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R5369:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R5371:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R5403:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R5436:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R5450:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R5532:Rsf1 UTSW 7 97,329,902 (GRCm39) missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97,311,328 (GRCm39) missense probably benign 0.02
R5657:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5689:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5745:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R5748:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R5773:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R5859:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6001:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6001:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6021:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6025:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6036:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6073:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6077:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6102:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6111:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6126:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6128:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6130:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6154:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6154:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6165:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6166:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6182:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6189:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6200:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6210:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6212:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6214:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6215:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6216:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6232:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6235:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6242:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6243:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6244:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6268:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6269:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6273:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6275:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R6286:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6291:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6293:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6297:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6302:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6309:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6312:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6324:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6343:Rsf1 UTSW 7 97,310,124 (GRCm39) missense probably benign 0.30
R6346:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6356:Rsf1 UTSW 7 97,311,141 (GRCm39) missense probably benign
R6370:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6378:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6394:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6398:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6406:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R6413:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6443:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6453:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R6471:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R6473:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6497:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6505:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6561:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6572:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6607:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6611:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6622:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6626:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6636:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6647:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6648:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6669:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6673:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R6679:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6685:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6695:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6697:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6726:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6739:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6747:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6751:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6771:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6773:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6787:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6800:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R6804:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6806:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6815:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6820:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6823:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6829:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6861:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6862:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6869:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6875:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6889:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6897:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6960:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6963:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6967:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6969:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6977:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6996:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7066:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7109:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7127:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R7138:Rsf1 UTSW 7 97,319,002 (GRCm39) missense
R7214:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R7217:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7238:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7246:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R7253:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7294:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7305:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7309:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7352:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7380:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7393:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7395:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7411:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7413:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7481:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7538:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7541:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7545:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7574:Rsf1 UTSW 7 97,310,374 (GRCm39) missense
R7578:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7599:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R7630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7632:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7710:Rsf1 UTSW 7 97,331,041 (GRCm39) missense
R7711:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7715:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7719:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7722:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7729:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7734:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7743:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7761:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7764:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7797:Rsf1 UTSW 7 97,310,692 (GRCm39) missense
R7802:Rsf1 UTSW 7 97,310,979 (GRCm39) missense
R7806:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7821:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7823:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R7824:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7825:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7826:Rsf1 UTSW 7 97,310,368 (GRCm39) unclassified probably benign
R7841:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R7854:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7862:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R7893:Rsf1 UTSW 7 97,311,165 (GRCm39) missense
R7923:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7924:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7927:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7931:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7951:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7957:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7960:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7979:Rsf1 UTSW 7 97,334,920 (GRCm39) missense
R7982:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7991:Rsf1 UTSW 7 97,310,540 (GRCm39) missense
R8028:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8030:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8042:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8062:Rsf1 UTSW 7 97,326,594 (GRCm39) missense
R8076:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8117:Rsf1 UTSW 7 97,288,464 (GRCm39) splice site probably null
R8132:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8153:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8155:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8166:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8197:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8235:Rsf1 UTSW 7 97,325,461 (GRCm39) utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R8282:Rsf1 UTSW 7 97,229,127 (GRCm39) frame shift probably null
R8301:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
R8315:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8343:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8370:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R8372:Rsf1 UTSW 7 97,311,624 (GRCm39) missense
R8376:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8382:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8392:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8410:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8443:Rsf1 UTSW 7 97,266,103 (GRCm39) missense
R8502:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8529:Rsf1 UTSW 7 97,320,074 (GRCm39) utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8554:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8558:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8735:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8742:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8772:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8862:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8866:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R8889:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8889:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8891:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8892:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8907:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8907:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R8913:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8916:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R8924:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8940:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8946:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8947:Rsf1 UTSW 7 97,331,059 (GRCm39) unclassified probably benign
R8951:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8975:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9033:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9044:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9060:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9066:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9079:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9080:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9094:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9096:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9101:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9102:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9123:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9125:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9126:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9128:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9157:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9159:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9161:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9187:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R9240:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9250:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9257:Rsf1 UTSW 7 97,334,918 (GRCm39) missense
R9288:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9345:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9406:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9411:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9414:Rsf1 UTSW 7 97,313,765 (GRCm39) critical splice acceptor site probably null
R9420:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R9421:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9423:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9427:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9448:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9452:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R9454:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9467:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R9468:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9483:Rsf1 UTSW 7 97,229,137 (GRCm39) unclassified probably benign
R9488:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R9502:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9507:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9509:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9519:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9526:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9581:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R9590:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9592:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9618:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9685:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9716:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9748:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9774:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9795:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9802:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
RF034:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
RF036:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
X0025:Rsf1 UTSW 7 97,285,651 (GRCm39) missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97,310,031 (GRCm39) nonsense probably null
Y4335:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCGGAGCCTTGAAGTCG -3'
(R):5'- CAGGGTATCTATGGAGAGCTAAAGC -3'

Sequencing Primer
(F):5'- TCGGAGCCTTGAAGTCGTAGAG -3'
(R):5'- TTCGGGCCGATCGCTTAC -3'
Posted On 2014-10-02