Mutagenetix > Incidental Mutation

Incidental Mutation 'R2207:Map1b'

239172

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

040209-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2207 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99431083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1710 (D1710G)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: D1710G

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: D1710G

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,106	V300A	probably benign	Het
2410137M14Rik	A	G	17: 36,978,073		probably benign	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abcb1b	C	T	5: 8,824,803	R488C	probably benign	Het
Adam34	T	C	8: 43,652,237	I124V	probably benign	Het
Aicda	T	A	6: 122,561,285	V134D	possibly damaging	Het
Akt2	T	A	7: 27,637,200		probably null	Het
Aldh1a3	T	C	7: 66,406,021	R341G	probably damaging	Het
Ankrd12	G	T	17: 66,031,574		probably null	Het
Anxa11	A	G	14: 25,874,297	Y244C	probably damaging	Het
Atp2c2	G	A	8: 119,748,309	R551Q	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bcl11a	G	T	11: 24,163,343	G229W	probably damaging	Het
Brip1	A	G	11: 86,061,877	V1026A	probably benign	Het
Cacna1h	A	T	17: 25,385,013	S1282T	probably benign	Het
Calcr	T	C	6: 3,717,133	Y109C	probably damaging	Het
Ccdc39	T	C	3: 33,836,733	I241V	probably damaging	Het
Ccdc9	A	G	7: 16,284,269		probably benign	Het
Cdk17	G	A	10: 93,228,762	D298N	probably damaging	Het
Cdkl3	A	G	11: 52,027,193	*354W	probably null	Het
Celf6	A	T	9: 59,604,327	Y401F	possibly damaging	Het
Clec4a4	C	T	6: 123,013,807	L169F	probably damaging	Het
Col14a1	T	C	15: 55,463,686	F1411L	unknown	Het
Col4a2	G	T	8: 11,443,352	G1354W	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cst13	A	T	2: 148,823,282	R66W	probably damaging	Het
Dhx8	A	G	11: 101,750,971	T632A	probably benign	Het
Disp1	A	G	1: 183,088,342	F838S	possibly damaging	Het
Dlg1	A	G	16: 31,853,846	H599R	probably benign	Het
Dnah12	T	A	14: 26,781,787	V1654E	probably damaging	Het
Dnah5	C	T	15: 28,343,671	L2406F	probably benign	Het
Fam98b	C	G	2: 117,267,819	R257G	probably damaging	Het
Fbn2	A	T	18: 58,081,399	C900*	probably null	Het
Fgf1	A	G	18: 38,847,085	Y79H	possibly damaging	Het
Foxn1	C	A	11: 78,358,804	A632S	probably benign	Het
Fsip2	T	G	2: 82,977,479	S1381A	probably benign	Het
Gtf2b	G	A	3: 142,778,320	G85D	probably benign	Het
Gyg	C	A	3: 20,150,539	G161C	probably damaging	Het
Hemgn	G	T	4: 46,396,301	L312I	possibly damaging	Het
Hic2	T	C	16: 17,257,460	M51T	possibly damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hpx	C	T	7: 105,592,426	R287H	probably damaging	Het
Igf2bp3	C	T	6: 49,088,554	G468E	possibly damaging	Het
Il5ra	C	A	6: 106,712,441	E397*	probably null	Het
Itfg1	A	T	8: 85,776,198	S246R	probably benign	Het
Kdm2a	A	T	19: 4,362,870	D29E	probably damaging	Het
Lamc2	T	G	1: 153,133,706	E784D	possibly damaging	Het
Lrp2	A	T	2: 69,467,028	N3196K	possibly damaging	Het
Lyzl1	T	A	18: 4,181,962	C96*	probably null	Het
Maf1	A	G	15: 76,352,518	T17A	probably benign	Het
Megf8	C	T	7: 25,349,797	T1773I	probably damaging	Het
Mei1	T	C	15: 82,103,249	M414T	probably benign	Het
Myo15	A	G	11: 60,506,034	N2643S	probably benign	Het
Ndufa9	A	G	6: 126,844,809	Y64H	probably damaging	Het
Neb	A	T	2: 52,211,567	L4354*	probably null	Het
Nom1	T	A	5: 29,439,974	I480N	probably damaging	Het
Nrxn3	C	T	12: 89,348,312	T331M	probably damaging	Het
Olfr1307	A	C	2: 111,944,925	F177C	probably damaging	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr403	G	T	11: 74,196,324	V274L	possibly damaging	Het
Olfr643	A	G	7: 104,059,405	S66P	probably damaging	Het
Pcdhb15	A	T	18: 37,475,022	T436S	probably benign	Het
Pcdhb18	T	A	18: 37,491,289	N557K	probably damaging	Het
Pcdhb6	T	C	18: 37,335,580	M518T	probably benign	Het
Pgm2l1	T	A	7: 100,268,112		probably null	Het
Pih1d2	C	A	9: 50,621,079	H162N	probably benign	Het
Pitrm1	T	A	13: 6,569,291	Y721N	probably damaging	Het
Pla2r1	C	A	2: 60,458,435	V618F	probably damaging	Het
Plb1	T	C	5: 32,316,640	S599P	possibly damaging	Het
Prkg1	T	C	19: 30,578,860	D562G	probably damaging	Het
Proser1	T	G	3: 53,478,391	S565A	probably benign	Het
Prx	T	A	7: 27,516,788	V238E	probably damaging	Het
Psapl1	T	C	5: 36,205,165	I367T	probably damaging	Het
Rc3h1	T	C	1: 160,940,025	V128A	probably damaging	Het
Rrm1	T	A	7: 102,442,026	M1K	probably null	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Rsl1	A	G	13: 67,182,828	T447A	probably benign	Het
Ryr2	A	G	13: 11,810,937	S552P	probably damaging	Het
Sbf1	A	G	15: 89,306,693	S225P	possibly damaging	Het
Serpina3c	T	A	12: 104,151,498	I194F	probably benign	Het
Setd3	C	T	12: 108,107,285	V578M	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc6a1	T	A	6: 114,308,671	V356E	probably damaging	Het
Slfn1	A	G	11: 83,121,166	E36G	possibly damaging	Het
Sorcs1	T	C	19: 50,230,217	H609R	possibly damaging	Het
Spag16	A	G	1: 70,724,884	H621R	probably benign	Het
Tg	G	A	15: 66,681,939	G401D	probably benign	Het
Tnxb	A	C	17: 34,709,417	T2602P	possibly damaging	Het
Trip11	T	C	12: 101,873,442	N1643S	probably benign	Het
Ttn	G	A	2: 76,879,343	R1581*	probably null	Het
Ttn	A	T	2: 76,965,811	I590K	probably benign	Het
Vmn1r225	A	G	17: 20,502,349	I17M	possibly damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Wdr7	T	A	18: 63,777,607	V690E	possibly damaging	Het
Xaf1	A	T	11: 72,303,402	E36D	possibly damaging	Het
Zfp131	A	T	13: 119,775,812	F303I	probably damaging	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het
Zfp788	A	T	7: 41,649,640	I567F	probably damaging	Het
Zfyve26	A	G	12: 79,246,087	V2096A	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGAGCTTCTCTCCTTCCAGG -3'
(R):5'- ATGTCTATTGAGTTCGGCCAGG -3'

Sequencing Primer
(F):5'- AGGCTCTGCACTTTTTCAGACG -3'
(R):5'- CTATTGAGTTCGGCCAGGAATCC -3'

Posted On

2014-10-02