Incidental Mutation 'R2207:Map1b'
ID239172
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Namemicrotubule-associated protein 1B
SynonymsMtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission 040209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2207 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location99421446-99516540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99431083 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1710 (D1710G)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: D1710G
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: D1710G

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abcb1b C T 5: 8,824,803 R488C probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Aicda T A 6: 122,561,285 V134D possibly damaging Het
Akt2 T A 7: 27,637,200 probably null Het
Aldh1a3 T C 7: 66,406,021 R341G probably damaging Het
Ankrd12 G T 17: 66,031,574 probably null Het
Anxa11 A G 14: 25,874,297 Y244C probably damaging Het
Atp2c2 G A 8: 119,748,309 R551Q probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bcl11a G T 11: 24,163,343 G229W probably damaging Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Ccdc39 T C 3: 33,836,733 I241V probably damaging Het
Ccdc9 A G 7: 16,284,269 probably benign Het
Cdk17 G A 10: 93,228,762 D298N probably damaging Het
Cdkl3 A G 11: 52,027,193 *354W probably null Het
Celf6 A T 9: 59,604,327 Y401F possibly damaging Het
Clec4a4 C T 6: 123,013,807 L169F probably damaging Het
Col14a1 T C 15: 55,463,686 F1411L unknown Het
Col4a2 G T 8: 11,443,352 G1354W probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp1 A G 1: 183,088,342 F838S possibly damaging Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dnah12 T A 14: 26,781,787 V1654E probably damaging Het
Dnah5 C T 15: 28,343,671 L2406F probably benign Het
Fam98b C G 2: 117,267,819 R257G probably damaging Het
Fbn2 A T 18: 58,081,399 C900* probably null Het
Fgf1 A G 18: 38,847,085 Y79H possibly damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fsip2 T G 2: 82,977,479 S1381A probably benign Het
Gtf2b G A 3: 142,778,320 G85D probably benign Het
Gyg C A 3: 20,150,539 G161C probably damaging Het
Hemgn G T 4: 46,396,301 L312I possibly damaging Het
Hic2 T C 16: 17,257,460 M51T possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hpx C T 7: 105,592,426 R287H probably damaging Het
Igf2bp3 C T 6: 49,088,554 G468E possibly damaging Het
Il5ra C A 6: 106,712,441 E397* probably null Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kdm2a A T 19: 4,362,870 D29E probably damaging Het
Lamc2 T G 1: 153,133,706 E784D possibly damaging Het
Lrp2 A T 2: 69,467,028 N3196K possibly damaging Het
Lyzl1 T A 18: 4,181,962 C96* probably null Het
Maf1 A G 15: 76,352,518 T17A probably benign Het
Megf8 C T 7: 25,349,797 T1773I probably damaging Het
Mei1 T C 15: 82,103,249 M414T probably benign Het
Myo15 A G 11: 60,506,034 N2643S probably benign Het
Ndufa9 A G 6: 126,844,809 Y64H probably damaging Het
Neb A T 2: 52,211,567 L4354* probably null Het
Nom1 T A 5: 29,439,974 I480N probably damaging Het
Nrxn3 C T 12: 89,348,312 T331M probably damaging Het
Olfr1307 A C 2: 111,944,925 F177C probably damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Olfr643 A G 7: 104,059,405 S66P probably damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pgm2l1 T A 7: 100,268,112 probably null Het
Pih1d2 C A 9: 50,621,079 H162N probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Pla2r1 C A 2: 60,458,435 V618F probably damaging Het
Plb1 T C 5: 32,316,640 S599P possibly damaging Het
Prkg1 T C 19: 30,578,860 D562G probably damaging Het
Proser1 T G 3: 53,478,391 S565A probably benign Het
Prx T A 7: 27,516,788 V238E probably damaging Het
Psapl1 T C 5: 36,205,165 I367T probably damaging Het
Rc3h1 T C 1: 160,940,025 V128A probably damaging Het
Rrm1 T A 7: 102,442,026 M1K probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Ryr2 A G 13: 11,810,937 S552P probably damaging Het
Sbf1 A G 15: 89,306,693 S225P possibly damaging Het
Serpina3c T A 12: 104,151,498 I194F probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a1 T A 6: 114,308,671 V356E probably damaging Het
Slfn1 A G 11: 83,121,166 E36G possibly damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Spag16 A G 1: 70,724,884 H621R probably benign Het
Tg G A 15: 66,681,939 G401D probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Ttn A T 2: 76,965,811 I590K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zfp131 A T 13: 119,775,812 F303I probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp788 A T 7: 41,649,640 I567F probably damaging Het
Zfyve26 A G 12: 79,246,087 V2096A probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGAGCTTCTCTCCTTCCAGG -3'
(R):5'- ATGTCTATTGAGTTCGGCCAGG -3'

Sequencing Primer
(F):5'- AGGCTCTGCACTTTTTCAGACG -3'
(R):5'- CTATTGAGTTCGGCCAGGAATCC -3'
Posted On2014-10-02