Incidental Mutation 'R0183:Appl1'
ID23918
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0183 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26962854 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 79 (D79E)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect probably damaging
Transcript: ENSMUST00000036570
AA Change: D79E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: D79E

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224406
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8129:Appl1 UTSW 14 26949509 missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGAATAAACTcacacatgcacatgcac -3'
(R):5'- AAGGTTGCCGTCTGCTTTTCCA -3'

Sequencing Primer
(F):5'- cacacacatacatacactctcac -3'
(R):5'- aaatcctgcctgcctctg -3'
Posted On2013-04-16