Incidental Mutation 'R2207:Cacna1h'
ID239188
Institutional Source Beutler Lab
Gene Symbol Cacna1h
Ensembl Gene ENSMUSG00000024112
Gene Namecalcium channel, voltage-dependent, T type, alpha 1H subunit
SynonymsCav3.2, alpha13.2, T-type Cav3.2
MMRRC Submission 040209-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2207 (G1)
Quality Score165
Status Not validated
Chromosome17
Chromosomal Location25374285-25433783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25385013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1282 (S1282T)
Ref Sequence ENSEMBL: ENSMUSP00000125541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610]
Predicted Effect probably benign
Transcript: ENSMUST00000078496
AA Change: S1282T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: S1282T

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159048
AA Change: S1176T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: S1176T

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159610
AA Change: S1282T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: S1282T

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161035
SMART Domains Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 1 73 2.1e-9 PFAM
Pfam:Ion_trans 72 170 2.8e-17 PFAM
Blast:Tryp_SPc 209 291 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162820
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abcb1b C T 5: 8,824,803 R488C probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Aicda T A 6: 122,561,285 V134D possibly damaging Het
Akt2 T A 7: 27,637,200 probably null Het
Aldh1a3 T C 7: 66,406,021 R341G probably damaging Het
Ankrd12 G T 17: 66,031,574 probably null Het
Anxa11 A G 14: 25,874,297 Y244C probably damaging Het
Atp2c2 G A 8: 119,748,309 R551Q probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bcl11a G T 11: 24,163,343 G229W probably damaging Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Ccdc39 T C 3: 33,836,733 I241V probably damaging Het
Ccdc9 A G 7: 16,284,269 probably benign Het
Cdk17 G A 10: 93,228,762 D298N probably damaging Het
Cdkl3 A G 11: 52,027,193 *354W probably null Het
Celf6 A T 9: 59,604,327 Y401F possibly damaging Het
Clec4a4 C T 6: 123,013,807 L169F probably damaging Het
Col14a1 T C 15: 55,463,686 F1411L unknown Het
Col4a2 G T 8: 11,443,352 G1354W probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp1 A G 1: 183,088,342 F838S possibly damaging Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dnah12 T A 14: 26,781,787 V1654E probably damaging Het
Dnah5 C T 15: 28,343,671 L2406F probably benign Het
Fam98b C G 2: 117,267,819 R257G probably damaging Het
Fbn2 A T 18: 58,081,399 C900* probably null Het
Fgf1 A G 18: 38,847,085 Y79H possibly damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fsip2 T G 2: 82,977,479 S1381A probably benign Het
Gtf2b G A 3: 142,778,320 G85D probably benign Het
Gyg C A 3: 20,150,539 G161C probably damaging Het
Hemgn G T 4: 46,396,301 L312I possibly damaging Het
Hic2 T C 16: 17,257,460 M51T possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hpx C T 7: 105,592,426 R287H probably damaging Het
Igf2bp3 C T 6: 49,088,554 G468E possibly damaging Het
Il5ra C A 6: 106,712,441 E397* probably null Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kdm2a A T 19: 4,362,870 D29E probably damaging Het
Lamc2 T G 1: 153,133,706 E784D possibly damaging Het
Lrp2 A T 2: 69,467,028 N3196K possibly damaging Het
Lyzl1 T A 18: 4,181,962 C96* probably null Het
Maf1 A G 15: 76,352,518 T17A probably benign Het
Map1b T C 13: 99,431,083 D1710G unknown Het
Megf8 C T 7: 25,349,797 T1773I probably damaging Het
Mei1 T C 15: 82,103,249 M414T probably benign Het
Myo15 A G 11: 60,506,034 N2643S probably benign Het
Ndufa9 A G 6: 126,844,809 Y64H probably damaging Het
Neb A T 2: 52,211,567 L4354* probably null Het
Nom1 T A 5: 29,439,974 I480N probably damaging Het
Nrxn3 C T 12: 89,348,312 T331M probably damaging Het
Olfr1307 A C 2: 111,944,925 F177C probably damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Olfr643 A G 7: 104,059,405 S66P probably damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pgm2l1 T A 7: 100,268,112 probably null Het
Pih1d2 C A 9: 50,621,079 H162N probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Pla2r1 C A 2: 60,458,435 V618F probably damaging Het
Plb1 T C 5: 32,316,640 S599P possibly damaging Het
Prkg1 T C 19: 30,578,860 D562G probably damaging Het
Proser1 T G 3: 53,478,391 S565A probably benign Het
Prx T A 7: 27,516,788 V238E probably damaging Het
Psapl1 T C 5: 36,205,165 I367T probably damaging Het
Rc3h1 T C 1: 160,940,025 V128A probably damaging Het
Rrm1 T A 7: 102,442,026 M1K probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Ryr2 A G 13: 11,810,937 S552P probably damaging Het
Sbf1 A G 15: 89,306,693 S225P possibly damaging Het
Serpina3c T A 12: 104,151,498 I194F probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a1 T A 6: 114,308,671 V356E probably damaging Het
Slfn1 A G 11: 83,121,166 E36G possibly damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Spag16 A G 1: 70,724,884 H621R probably benign Het
Tg G A 15: 66,681,939 G401D probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Ttn A T 2: 76,965,811 I590K probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zfp131 A T 13: 119,775,812 F303I probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp788 A T 7: 41,649,640 I567F probably damaging Het
Zfyve26 A G 12: 79,246,087 V2096A probably damaging Het
Other mutations in Cacna1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cacna1h APN 17 25381508 missense probably damaging 1.00
IGL01412:Cacna1h APN 17 25391950 missense probably benign 0.24
IGL01625:Cacna1h APN 17 25383485 missense probably damaging 0.97
IGL01625:Cacna1h APN 17 25385712 missense possibly damaging 0.95
IGL01684:Cacna1h APN 17 25388716 missense probably damaging 1.00
IGL01862:Cacna1h APN 17 25383483 missense probably damaging 1.00
IGL01877:Cacna1h APN 17 25388050 missense probably damaging 1.00
IGL02040:Cacna1h APN 17 25397611 missense probably benign 0.10
IGL02190:Cacna1h APN 17 25433026 missense probably benign
IGL02686:Cacna1h APN 17 25385749 missense possibly damaging 0.80
IGL02883:Cacna1h APN 17 25380532 missense probably damaging 1.00
IGL02945:Cacna1h APN 17 25388059 missense probably damaging 1.00
IGL03025:Cacna1h APN 17 25432894 nonsense probably null
IGL03095:Cacna1h APN 17 25383778 unclassified probably benign
IGL03207:Cacna1h APN 17 25391333 missense probably damaging 1.00
IGL02991:Cacna1h UTSW 17 25391312 missense possibly damaging 0.56
IGL03097:Cacna1h UTSW 17 25391144 missense probably damaging 1.00
R0010:Cacna1h UTSW 17 25380844 missense probably damaging 1.00
R0194:Cacna1h UTSW 17 25380924 unclassified probably benign
R0361:Cacna1h UTSW 17 25389422 missense probably damaging 1.00
R0501:Cacna1h UTSW 17 25388667 missense probably damaging 1.00
R0558:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R0588:Cacna1h UTSW 17 25387564 missense probably damaging 1.00
R0626:Cacna1h UTSW 17 25393546 missense possibly damaging 0.92
R0811:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0812:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0964:Cacna1h UTSW 17 25378775 unclassified probably benign
R1351:Cacna1h UTSW 17 25391951 missense probably benign 0.14
R1457:Cacna1h UTSW 17 25397620 missense probably damaging 1.00
R1521:Cacna1h UTSW 17 25397354 missense possibly damaging 0.57
R1564:Cacna1h UTSW 17 25377861 nonsense probably null
R1611:Cacna1h UTSW 17 25381471 missense probably damaging 1.00
R1669:Cacna1h UTSW 17 25383471 missense probably damaging 1.00
R1835:Cacna1h UTSW 17 25392076 missense probably benign 0.01
R1858:Cacna1h UTSW 17 25380807 missense probably damaging 1.00
R1887:Cacna1h UTSW 17 25376887 missense probably benign 0.01
R2039:Cacna1h UTSW 17 25391845 missense probably benign 0.03
R2091:Cacna1h UTSW 17 25432876 missense possibly damaging 0.95
R2133:Cacna1h UTSW 17 25383528 missense probably damaging 1.00
R2203:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2205:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2206:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2224:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2226:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2261:Cacna1h UTSW 17 25433165 missense possibly damaging 0.91
R2361:Cacna1h UTSW 17 25384012 missense probably damaging 1.00
R2917:Cacna1h UTSW 17 25395452 missense probably damaging 0.97
R3031:Cacna1h UTSW 17 25433134 missense probably damaging 0.99
R3856:Cacna1h UTSW 17 25392453 missense probably damaging 1.00
R4230:Cacna1h UTSW 17 25387863 missense probably damaging 1.00
R4408:Cacna1h UTSW 17 25380627 missense probably damaging 1.00
R4687:Cacna1h UTSW 17 25393910 missense possibly damaging 0.47
R4887:Cacna1h UTSW 17 25377287 missense possibly damaging 0.86
R4895:Cacna1h UTSW 17 25389422 missense probably damaging 0.99
R5067:Cacna1h UTSW 17 25397808 missense probably damaging 1.00
R5077:Cacna1h UTSW 17 25375250 missense probably benign 0.02
R5148:Cacna1h UTSW 17 25387545 missense probably damaging 1.00
R5336:Cacna1h UTSW 17 25392231 missense probably damaging 0.99
R5450:Cacna1h UTSW 17 25383186 missense probably damaging 1.00
R5616:Cacna1h UTSW 17 25377667 missense probably damaging 1.00
R5738:Cacna1h UTSW 17 25387049 missense probably damaging 0.99
R5883:Cacna1h UTSW 17 25376922 missense probably benign 0.00
R5954:Cacna1h UTSW 17 25383201 missense probably damaging 1.00
R5961:Cacna1h UTSW 17 25377272 missense probably benign 0.01
R6110:Cacna1h UTSW 17 25391276 missense probably benign 0.10
R6125:Cacna1h UTSW 17 25385694 missense probably benign 0.00
R6189:Cacna1h UTSW 17 25397844 missense probably damaging 1.00
R6216:Cacna1h UTSW 17 25378819 missense probably damaging 1.00
R6259:Cacna1h UTSW 17 25397656 critical splice acceptor site probably null
R6296:Cacna1h UTSW 17 25383079 missense probably damaging 1.00
R6394:Cacna1h UTSW 17 25387481 missense probably benign 0.32
R6695:Cacna1h UTSW 17 25393740 missense probably damaging 1.00
R6746:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R6914:Cacna1h UTSW 17 25385039 missense probably benign
R6942:Cacna1h UTSW 17 25385039 missense probably benign
R6955:Cacna1h UTSW 17 25388056 missense probably damaging 1.00
R7041:Cacna1h UTSW 17 25394003 missense probably damaging 0.98
R7120:Cacna1h UTSW 17 25391507 missense probably benign 0.31
R7125:Cacna1h UTSW 17 25383536 missense probably damaging 0.99
R7182:Cacna1h UTSW 17 25377655 missense probably damaging 1.00
R7270:Cacna1h UTSW 17 25384765 missense probably damaging 1.00
R7274:Cacna1h UTSW 17 25378837 missense probably damaging 1.00
R7319:Cacna1h UTSW 17 25389461 missense possibly damaging 0.94
R7406:Cacna1h UTSW 17 25385626 missense possibly damaging 0.56
R7634:Cacna1h UTSW 17 25392109 missense possibly damaging 0.87
R7684:Cacna1h UTSW 17 25389372 missense probably damaging 0.99
R7769:Cacna1h UTSW 17 25385805 missense probably damaging 1.00
R7856:Cacna1h UTSW 17 25389477 missense probably damaging 0.98
R7876:Cacna1h UTSW 17 25375251 missense probably benign
R7898:Cacna1h UTSW 17 25392276 missense probably damaging 1.00
R8038:Cacna1h UTSW 17 25375891 missense probably damaging 0.97
R8042:Cacna1h UTSW 17 25392471 nonsense probably null
R8139:Cacna1h UTSW 17 25383723 missense probably damaging 1.00
R8391:Cacna1h UTSW 17 25377230 missense probably benign 0.00
V1662:Cacna1h UTSW 17 25377309 missense possibly damaging 0.68
Z1176:Cacna1h UTSW 17 25391250 missense probably benign
Z1177:Cacna1h UTSW 17 25375892 missense probably damaging 1.00
Z1177:Cacna1h UTSW 17 25391378 missense probably damaging 0.99
Z1177:Cacna1h UTSW 17 25393584 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AACATCTTGTGTGCGATGACTTTC -3'
(R):5'- GCAACAAAGACTGGCCTGAG -3'

Sequencing Primer
(F):5'- CGATGACTTTCTGGCAGGAGAC -3'
(R):5'- AGACTGGCCTGAGGTGGG -3'
Posted On2014-10-02