Incidental Mutation 'R0184:Pip4k2a'
ID23921
Institutional Source Beutler Lab
Gene Symbol Pip4k2a
Ensembl Gene ENSMUSG00000026737
Gene Namephosphatidylinositol-5-phosphate 4-kinase, type II, alpha
SynonymsPip5k2a
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0184 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location18842255-18998126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18889128 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000006912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006912]
Predicted Effect probably damaging
Transcript: ENSMUST00000006912
AA Change: D139G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006912
Gene: ENSMUSG00000026737
AA Change: D139G

DomainStartEndE-ValueType
PIPKc 62 405 1.19e-169 SMART
Predicted Effect unknown
Transcript: ENSMUST00000152981
AA Change: D41G
SMART Domains Protein: ENSMUSP00000119075
Gene: ENSMUSG00000026737
AA Change: D41G

DomainStartEndE-ValueType
Pfam:PIP5K 18 198 1.4e-43 PFAM
Meta Mutation Damage Score 0.9239 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Pip4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Pip4k2a APN 2 18872336 missense probably benign 0.10
IGL01682:Pip4k2a APN 2 18997968 missense probably benign
IGL02379:Pip4k2a APN 2 18866111 critical splice donor site probably null
R0096:Pip4k2a UTSW 2 18889039 splice site probably benign
R0514:Pip4k2a UTSW 2 18845936 missense probably damaging 0.99
R1673:Pip4k2a UTSW 2 18872282 critical splice donor site probably null
R1779:Pip4k2a UTSW 2 18847622 missense probably benign 0.27
R2198:Pip4k2a UTSW 2 18847655 missense probably damaging 0.98
R4555:Pip4k2a UTSW 2 18872292 missense probably damaging 0.99
R5408:Pip4k2a UTSW 2 18906308 missense probably benign 0.03
R7598:Pip4k2a UTSW 2 18872287 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGTGTTGGCCTTGAAGACACCC -3'
(R):5'- AGTGTAGAACTCACTGCCACCCTC -3'

Sequencing Primer
(F):5'- CTGGCATGAAGATAAACCTGCTC -3'
(R):5'- GTGAAATATTGCCAGCCATTACCAG -3'
Posted On2013-04-16