Mutagenetix > Incidental Mutation

Incidental Mutation 'R0183:Spef2'

23926

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

038448-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R0183 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9578279-9748954 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9716445 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 323 (D323E)

Ref Sequence

ENSEMBL: ENSMUSP00000146967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]

AlphaFold

Q8C9J3

Predicted Effect

probably benign
Transcript: ENSMUST00000041840
AA Change: D323E

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: D323E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159093
AA Change: D380E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: D380E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159288
AA Change: D323E

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: D323E

Domain	Start	End	E-Value	Type
Pfam:CH_2	5	102	3.1e-25	PFAM
low complexity region	106	115	N/A	INTRINSIC
low complexity region	137	148	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	602	789	8.8e-11	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1221	N/A	INTRINSIC
low complexity region	1264	1278	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
SCOP:d1rec__	1378	1530	3e-3	SMART
low complexity region	1605	1624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159368
AA Change: D323E

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: D323E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	162	1.4e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160236
AA Change: D323E

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: D323E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162780
AA Change: D380E

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: D380E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	164	1.1e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208854
AA Change: D323E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

84% (42/50)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	T	5: 77,034,082 (GRCm39)	D490N	probably benign	Het
Aatf	A	T	11: 84,401,251 (GRCm39)		probably null	Het
Amer3	T	A	1: 34,626,838 (GRCm39)	I359K	probably damaging	Het
Appl1	A	T	14: 26,684,811 (GRCm39)	D79E	probably damaging	Het
Ass1	A	T	2: 31,404,831 (GRCm39)	N371Y	probably damaging	Het
Baz1a	T	A	12: 54,958,172 (GRCm39)	E1026D	probably damaging	Het
Bcl2	G	A	1: 106,640,292 (GRCm39)	R107C	probably damaging	Het
Card14	C	T	11: 119,217,524 (GRCm39)	R386C	probably damaging	Het
Cenpb	T	C	2: 131,020,373 (GRCm39)		probably benign	Het
Clcn4	G	A	7: 7,298,090 (GRCm39)	Q40*	probably null	Het
Clec16a	T	C	16: 10,377,886 (GRCm39)	Y28H	probably damaging	Het
Cul4a	T	C	8: 13,183,790 (GRCm39)	S393P	probably damaging	Het
Dcbld2	A	G	16: 58,265,722 (GRCm39)	D194G	possibly damaging	Het
Dnah6	C	T	6: 73,059,906 (GRCm39)	V2841I	probably damaging	Het
Eaf1	T	A	14: 31,217,272 (GRCm39)	L16Q	probably damaging	Het
Eef1e1	C	T	13: 38,840,162 (GRCm39)	A48T	probably damaging	Het
Exoc3l	C	A	8: 106,021,932 (GRCm39)	R57L	probably damaging	Het
Faf1	A	G	4: 109,792,807 (GRCm39)	N593S	probably benign	Het
Fosb	A	G	7: 19,041,310 (GRCm39)	I61T	probably damaging	Het
Fstl5	A	C	3: 76,229,579 (GRCm39)	I127L	possibly damaging	Het
Gas2l2	T	A	11: 83,319,882 (GRCm39)	M125L	probably benign	Het
Gcnt1	C	T	19: 17,306,481 (GRCm39)	D415N	probably benign	Het
Gtpbp4	A	G	13: 9,024,997 (GRCm39)	M531T	probably benign	Het
Gucy1b2	T	A	14: 62,656,589 (GRCm39)	K256M	probably damaging	Het
Igf2bp2	A	T	16: 21,897,480 (GRCm39)	Y244*	probably null	Het
Jkamp	T	C	12: 72,140,809 (GRCm39)	I118T	possibly damaging	Het
Kalrn	A	T	16: 33,991,749 (GRCm39)		probably null	Het
Kcnma1	A	T	14: 23,558,120 (GRCm39)	D317E	probably damaging	Het
Lipo2	A	T	19: 33,726,951 (GRCm39)		probably null	Het
Lrig3	T	A	10: 125,846,061 (GRCm39)	I830K	probably damaging	Het
Map3k4	A	G	17: 12,454,015 (GRCm39)	I1429T	probably damaging	Het
Mkks	G	A	2: 136,722,606 (GRCm39)	L184F	probably benign	Het
Mmp19	C	T	10: 128,634,872 (GRCm39)	T424I	possibly damaging	Het
Mrps23	A	G	11: 88,100,980 (GRCm39)	E57G	probably damaging	Het
Myh7	T	C	14: 55,216,333 (GRCm39)	T1282A	probably benign	Het
Or2y10	A	G	11: 49,455,675 (GRCm39)	D309G	probably benign	Het
Or8k1	T	A	2: 86,047,173 (GRCm39)	S294C	probably damaging	Het
Phf19	T	C	2: 34,801,214 (GRCm39)	N75S	probably damaging	Het
Pink1	T	G	4: 138,041,490 (GRCm39)	H477P	probably damaging	Het
Ppp6r2	G	A	15: 89,169,990 (GRCm39)	C835Y	probably damaging	Het
Prkcq	T	C	2: 11,257,973 (GRCm39)	I295T	probably damaging	Het
Ptpn13	T	C	5: 103,664,274 (GRCm39)	S421P	probably benign	Het
Ptpn6	A	G	6: 124,705,914 (GRCm39)	S77P	probably damaging	Het
Ptpre	G	T	7: 135,271,574 (GRCm39)	M389I	probably benign	Het
Ranbp9	T	C	13: 43,578,599 (GRCm39)	D158G	probably damaging	Het
Sec14l3	C	T	11: 4,025,547 (GRCm39)	S357L	probably benign	Het
Slc1a6	A	G	10: 78,627,067 (GRCm39)	T135A	probably damaging	Het
Taf2	T	A	15: 54,919,186 (GRCm39)	K396N	possibly damaging	Het
Tcf12	A	T	9: 71,824,309 (GRCm39)	V94E	probably damaging	Het
Trim24	T	A	6: 37,920,415 (GRCm39)	I404N	possibly damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9,740,621 (GRCm39)	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9,663,181 (GRCm39)	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9,716,499 (GRCm39)	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9,676,376 (GRCm39)	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9,663,244 (GRCm39)	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9,704,466 (GRCm39)	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9,717,662 (GRCm39)	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9,717,584 (GRCm39)	nonsense	probably null
IGL02605:Spef2	APN	15	9,725,238 (GRCm39)	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9,748,853 (GRCm39)	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9,679,432 (GRCm39)	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9,668,960 (GRCm39)	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9,713,329 (GRCm39)	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9,725,192 (GRCm39)	splice site	probably benign
IGL03263:Spef2	APN	15	9,667,305 (GRCm39)	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9,676,466 (GRCm39)	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9,713,194 (GRCm39)	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9,713,194 (GRCm39)	missense	probably damaging	1.00
R0386:Spef2	UTSW	15	9,584,148 (GRCm39)	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9,584,070 (GRCm39)	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9,592,844 (GRCm39)	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9,626,217 (GRCm39)	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9,687,899 (GRCm39)	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9,614,281 (GRCm39)	splice site	probably null
R0939:Spef2	UTSW	15	9,704,636 (GRCm39)	splice site	probably null
R0973:Spef2	UTSW	15	9,716,482 (GRCm39)	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9,725,194 (GRCm39)	splice site	probably benign
R1392:Spef2	UTSW	15	9,647,349 (GRCm39)	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9,647,349 (GRCm39)	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9,596,793 (GRCm39)	unclassified	probably benign
R1518:Spef2	UTSW	15	9,667,316 (GRCm39)	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9,596,660 (GRCm39)	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9,634,738 (GRCm39)	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9,614,295 (GRCm39)	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9,717,568 (GRCm39)	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9,679,435 (GRCm39)	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9,597,487 (GRCm39)	missense	possibly damaging	0.78
R1875:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1897:Spef2	UTSW	15	9,729,740 (GRCm39)	nonsense	probably null
R1901:Spef2	UTSW	15	9,607,463 (GRCm39)	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9,607,463 (GRCm39)	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9,663,280 (GRCm39)	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9,609,602 (GRCm39)	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9,663,152 (GRCm39)	makesense	probably null
R1998:Spef2	UTSW	15	9,668,989 (GRCm39)	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9,668,989 (GRCm39)	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9,713,271 (GRCm39)	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9,589,659 (GRCm39)	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9,729,747 (GRCm39)	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9,626,120 (GRCm39)	nonsense	probably null
R2517:Spef2	UTSW	15	9,725,283 (GRCm39)	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9,630,699 (GRCm39)	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9,682,709 (GRCm39)	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9,704,622 (GRCm39)	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9,626,107 (GRCm39)	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9,676,407 (GRCm39)	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9,667,366 (GRCm39)	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9,679,429 (GRCm39)	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9,679,429 (GRCm39)	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9,647,303 (GRCm39)	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9,647,524 (GRCm39)	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9,676,459 (GRCm39)	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9,647,576 (GRCm39)	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9,653,040 (GRCm39)	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9,713,264 (GRCm39)	nonsense	probably null
R5004:Spef2	UTSW	15	9,578,413 (GRCm39)	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9,668,877 (GRCm39)	nonsense	probably null
R5230:Spef2	UTSW	15	9,667,316 (GRCm39)	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9,596,777 (GRCm39)	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9,614,367 (GRCm39)	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9,583,922 (GRCm39)	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9,729,789 (GRCm39)	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9,609,606 (GRCm39)	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9,748,812 (GRCm39)	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9,614,301 (GRCm39)	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9,727,618 (GRCm39)	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9,626,059 (GRCm39)	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9,600,604 (GRCm39)	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9,592,835 (GRCm39)	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9,685,021 (GRCm39)	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9,597,426 (GRCm39)	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9,725,257 (GRCm39)	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9,729,924 (GRCm39)	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9,717,689 (GRCm39)	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9,601,726 (GRCm39)	missense	unknown
R7263:Spef2	UTSW	15	9,653,098 (GRCm39)	splice site	probably null
R7270:Spef2	UTSW	15	9,600,066 (GRCm39)	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9,647,576 (GRCm39)	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9,584,293 (GRCm39)	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9,740,671 (GRCm39)	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9,727,625 (GRCm39)	missense	probably benign
R7587:Spef2	UTSW	15	9,713,305 (GRCm39)	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9,653,031 (GRCm39)	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9,704,567 (GRCm39)	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9,609,637 (GRCm39)	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9,596,730 (GRCm39)	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9,687,981 (GRCm39)	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9,717,649 (GRCm39)	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9,601,171 (GRCm39)	missense	unknown
R8105:Spef2	UTSW	15	9,682,748 (GRCm39)	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9,601,598 (GRCm39)	missense	unknown
R8296:Spef2	UTSW	15	9,727,629 (GRCm39)	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9,676,615 (GRCm39)	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9,612,643 (GRCm39)	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9,600,765 (GRCm39)	intron	probably benign
R8691:Spef2	UTSW	15	9,602,005 (GRCm39)	nonsense	probably null
R8751:Spef2	UTSW	15	9,729,723 (GRCm39)	nonsense	probably null
R8847:Spef2	UTSW	15	9,668,913 (GRCm39)	missense	probably benign
R8864:Spef2	UTSW	15	9,599,833 (GRCm39)	missense	unknown
R8868:Spef2	UTSW	15	9,729,747 (GRCm39)	missense	possibly damaging	0.53
R8916:Spef2	UTSW	15	9,725,266 (GRCm39)	nonsense	probably null
R8935:Spef2	UTSW	15	9,607,436 (GRCm39)	missense	probably damaging	0.98
R8961:Spef2	UTSW	15	9,647,414 (GRCm39)	missense	possibly damaging	0.92
R8978:Spef2	UTSW	15	9,725,263 (GRCm39)	missense	possibly damaging	0.81
R9062:Spef2	UTSW	15	9,601,717 (GRCm39)	missense	unknown
R9076:Spef2	UTSW	15	9,653,091 (GRCm39)	missense	probably benign	0.13
R9149:Spef2	UTSW	15	9,717,568 (GRCm39)	missense	probably damaging	1.00
R9162:Spef2	UTSW	15	9,602,017 (GRCm39)	missense	unknown
R9216:Spef2	UTSW	15	9,647,611 (GRCm39)	missense	probably damaging	1.00
R9240:Spef2	UTSW	15	9,578,401 (GRCm39)	nonsense	probably null
R9278:Spef2	UTSW	15	9,727,495 (GRCm39)	critical splice donor site	probably null
R9341:Spef2	UTSW	15	9,713,190 (GRCm39)	missense	probably damaging	1.00
R9343:Spef2	UTSW	15	9,713,190 (GRCm39)	missense	probably damaging	1.00
R9389:Spef2	UTSW	15	9,725,307 (GRCm39)	missense	probably damaging	0.96
R9476:Spef2	UTSW	15	9,713,203 (GRCm39)	missense	probably damaging	1.00
R9510:Spef2	UTSW	15	9,713,203 (GRCm39)	missense	probably damaging	1.00
R9537:Spef2	UTSW	15	9,601,885 (GRCm39)	missense	unknown
R9575:Spef2	UTSW	15	9,596,672 (GRCm39)	missense	probably damaging	1.00
R9597:Spef2	UTSW	15	9,599,897 (GRCm39)	missense	unknown
R9765:Spef2	UTSW	15	9,601,945 (GRCm39)	missense	unknown
X0025:Spef2	UTSW	15	9,596,708 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGATAGGCaagtccattgggtgt -3'
(R):5'- ACTGACTTCTGAGCCACTGGGTAA -3'

Sequencing Primer
(F):5'- tgacaagcacgaacagagac -3'
(R):5'- CCACTGGGTAATATGAGCTTGAC -3'

Posted On

2013-04-16