Incidental Mutation 'R2209:Specc1l'
ID 239262
Institutional Source Beutler Lab
Gene Symbol Specc1l
Ensembl Gene ENSMUSG00000033444
Gene Name sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms Cytsa, Specc1l
MMRRC Submission 040211-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock # R2209 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 75212073-75312743 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75246576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 619 (D619G)
Ref Sequence ENSEMBL: ENSMUSP00000101061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766] [ENSMUST00000219387]
AlphaFold Q2KN98
Predicted Effect probably damaging
Transcript: ENSMUST00000040105
AA Change: D619G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: D619G

DomainStartEndE-ValueType
low complexity region 97 107 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
coiled coil region 255 298 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
coiled coil region 412 467 N/A INTRINSIC
coiled coil region 505 825 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 989 1010 N/A INTRINSIC
CH 1031 1129 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105421
AA Change: D619G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: D619G

DomainStartEndE-ValueType
low complexity region 80 90 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
coiled coil region 238 281 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
coiled coil region 395 450 N/A INTRINSIC
coiled coil region 488 808 N/A INTRINSIC
low complexity region 829 841 N/A INTRINSIC
low complexity region 972 993 N/A INTRINSIC
CH 1014 1112 1.52e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218766
AA Change: D602G

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218876
Predicted Effect probably benign
Transcript: ENSMUST00000219387
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,157,488 E330G possibly damaging Het
Apob A C 12: 8,007,752 D2078A probably benign Het
Arhgap21 T A 2: 20,849,520 Q1681L probably damaging Het
Arsb A G 13: 93,862,101 T306A probably benign Het
Brpf3 G A 17: 28,828,420 D1053N probably damaging Het
Ccdc130 C T 8: 84,263,869 V45I probably benign Het
Cenpf A T 1: 189,652,598 I2495N probably benign Het
Col12a1 T C 9: 79,692,352 K840E possibly damaging Het
Cry1 A G 10: 85,146,755 L269P probably damaging Het
Cyp21a1 C A 17: 34,802,727 E289* probably null Het
Dcp2 A T 18: 44,405,514 K215* probably null Het
Ecm2 A G 13: 49,530,156 N537D probably damaging Het
Emid1 G A 11: 5,135,407 T113M probably benign Het
Exoc8 C T 8: 124,896,179 W483* probably null Het
Fes A T 7: 80,380,283 N582K probably damaging Het
Flnb G T 14: 7,905,507 E1086* probably null Het
Flnc T A 6: 29,455,845 D2058E possibly damaging Het
Gatb G A 3: 85,653,805 D543N probably benign Het
Gm14412 A G 2: 177,317,436 V9A probably damaging Het
Gm4884 T C 7: 41,043,321 V238A possibly damaging Het
Igfbp5 A G 1: 72,873,937 V68A possibly damaging Het
Igflr1 T A 7: 30,567,797 I330N probably damaging Het
Il1r2 A G 1: 40,115,138 T222A probably benign Het
Krt87 T C 15: 101,433,108 E419G probably benign Het
Lman2 A G 13: 55,351,502 S187P probably damaging Het
Lrrc6 A G 15: 66,449,551 I247T probably benign Het
Mrpl38 T C 11: 116,138,462 E76G possibly damaging Het
Mtx3 A G 13: 92,847,604 I130V probably benign Het
Naf1 T G 8: 66,860,536 probably benign Het
Nkx2-1 T G 12: 56,533,508 M216L probably benign Het
Notch1 C A 2: 26,460,007 V2374L probably benign Het
Nrxn2 A G 19: 6,493,007 D1087G probably benign Het
Nudt8 T C 19: 4,001,902 F171S probably damaging Het
Olfr1434 T G 19: 12,283,860 F271V probably benign Het
Pds5a A T 5: 65,628,014 C916* probably null Het
Phyhip A T 14: 70,461,894 N46Y probably damaging Het
Pomt1 A G 2: 32,250,862 Y502C possibly damaging Het
Prkcg A C 7: 3,303,581 probably benign Het
Prl8a6 C T 13: 27,435,386 E118K probably benign Het
Prpf39 T C 12: 65,057,915 probably null Het
Ptprb A G 10: 116,369,357 H2159R probably damaging Het
Ripor2 A T 13: 24,701,612 D571V probably damaging Het
Rps19 C T 7: 24,885,127 L34F probably benign Het
Rusc1 A G 3: 89,088,821 S145P probably damaging Het
Scn4a T A 11: 106,339,225 T586S probably damaging Het
Slc7a12 A G 3: 14,481,064 S90G possibly damaging Het
Src A G 2: 157,462,790 D143G probably benign Het
Sst T C 16: 23,889,808 N91S probably benign Het
Stxbp5l T A 16: 37,216,036 I406F probably damaging Het
Thsd1 T A 8: 22,258,871 I525N probably damaging Het
Ticam2 A T 18: 46,560,400 F207I probably damaging Het
Tsc22d1 C A 14: 76,418,740 N31K probably damaging Het
Tspan10 T C 11: 120,446,163 V253A probably benign Het
Ttc33 A G 15: 5,208,443 K99R possibly damaging Het
Vmn1r63 T A 7: 5,803,213 N140I probably damaging Het
Zbtb25 A G 12: 76,349,129 *440Q probably null Het
Zfhx4 T A 3: 5,396,918 C1218S probably damaging Het
Zfp84 T A 7: 29,777,182 I433N probably damaging Het
Other mutations in Specc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Specc1l APN 10 75246221 missense probably benign 0.12
IGL01638:Specc1l APN 10 75246205 nonsense probably null
IGL01970:Specc1l APN 10 75245761 missense probably damaging 1.00
IGL02539:Specc1l APN 10 75267508 missense probably benign 0.39
IGL02737:Specc1l APN 10 75246324 missense probably damaging 0.99
IGL02941:Specc1l APN 10 75241188 missense probably benign 0.10
R0305:Specc1l UTSW 10 75245829 missense probably damaging 1.00
R0374:Specc1l UTSW 10 75248459 missense probably damaging 0.99
R0402:Specc1l UTSW 10 75246426 missense probably damaging 1.00
R1456:Specc1l UTSW 10 75246284 missense probably damaging 0.98
R1508:Specc1l UTSW 10 75307238 missense probably benign 0.00
R1861:Specc1l UTSW 10 75309859 missense probably damaging 1.00
R1869:Specc1l UTSW 10 75261825 missense probably damaging 1.00
R1929:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R1930:Specc1l UTSW 10 75309824 missense probably damaging 1.00
R2021:Specc1l UTSW 10 75267591 critical splice donor site probably null
R2271:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R2937:Specc1l UTSW 10 75259131 missense probably damaging 0.98
R4415:Specc1l UTSW 10 75246328 missense possibly damaging 0.92
R4758:Specc1l UTSW 10 75246348 missense probably damaging 0.99
R5344:Specc1l UTSW 10 75246173 missense possibly damaging 0.84
R5383:Specc1l UTSW 10 75246705 missense possibly damaging 0.86
R5426:Specc1l UTSW 10 75267550 missense probably benign 0.21
R5774:Specc1l UTSW 10 75245400 missense probably damaging 1.00
R5788:Specc1l UTSW 10 75276921 missense probably damaging 1.00
R6101:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6105:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6136:Specc1l UTSW 10 75246660 missense probably benign 0.38
R6345:Specc1l UTSW 10 75248488 missense probably damaging 0.99
R6459:Specc1l UTSW 10 75246167 missense probably damaging 1.00
R6641:Specc1l UTSW 10 75246549 missense probably damaging 1.00
R6996:Specc1l UTSW 10 75246279 missense probably benign 0.23
R7100:Specc1l UTSW 10 75245495 missense probably benign 0.21
R7475:Specc1l UTSW 10 75246447 missense possibly damaging 0.59
R7545:Specc1l UTSW 10 75245087 missense probably benign 0.00
R7615:Specc1l UTSW 10 75263286 missense probably benign 0.02
R7635:Specc1l UTSW 10 75276804 missense probably damaging 1.00
R7640:Specc1l UTSW 10 75257869 missense probably damaging 1.00
R7682:Specc1l UTSW 10 75245802 missense probably damaging 0.99
R7711:Specc1l UTSW 10 75230808 missense probably benign 0.02
R7742:Specc1l UTSW 10 75246417 missense probably benign 0.01
R7847:Specc1l UTSW 10 75309836 missense probably damaging 0.99
R8015:Specc1l UTSW 10 75241068 missense probably benign 0.17
R8030:Specc1l UTSW 10 75248555 missense probably damaging 1.00
R8882:Specc1l UTSW 10 75229855 start codon destroyed unknown
R9069:Specc1l UTSW 10 75230806 missense probably benign 0.03
R9790:Specc1l UTSW 10 75230769 missense probably benign 0.21
R9791:Specc1l UTSW 10 75230769 missense probably benign 0.21
X0021:Specc1l UTSW 10 75274040 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAAGAAATGATAGGTGCCC -3'
(R):5'- CCACATGGCAGCTGTATAAAC -3'

Sequencing Primer
(F):5'- TGATAGGTGCCCTCAAAGAGC -3'
(R):5'- CATGGCAGCTGTATAAACTAAACAAG -3'
Posted On 2014-10-15