Incidental Mutation 'R2209:Zbtb25'
ID 239274
Institutional Source Beutler Lab
Gene Symbol Zbtb25
Ensembl Gene ENSMUSG00000056459
Gene Name zinc finger and BTB domain containing 25
Synonyms Kup, Zfp-50, Zfp50, 2810462M08Rik, 2900064P18Rik
MMRRC Submission 040211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R2209 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 76347782-76369602 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 76349129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Glutamine at position 440 (*440Q)
Ref Sequence ENSEMBL: ENSMUSP00000134748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167011] [ENSMUST00000176102] [ENSMUST00000176187] [ENSMUST00000176278] [ENSMUST00000176509] [ENSMUST00000176967]
AlphaFold G3UW50
Predicted Effect probably null
Transcript: ENSMUST00000167011
AA Change: *440Q
SMART Domains Protein: ENSMUSP00000128471
Gene: ENSMUSG00000056459
AA Change: *440Q

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
low complexity region 213 224 N/A INTRINSIC
ZnF_C2H2 239 261 4.4e-2 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176102
AA Change: *440Q
SMART Domains Protein: ENSMUSP00000135853
Gene: ENSMUSG00000056459
AA Change: *440Q

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
low complexity region 213 224 N/A INTRINSIC
ZnF_C2H2 239 261 4.4e-2 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176187
SMART Domains Protein: ENSMUSP00000135458
Gene: ENSMUSG00000056459

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176278
AA Change: *440Q
SMART Domains Protein: ENSMUSP00000134748
Gene: ENSMUSG00000056459
AA Change: *440Q

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
low complexity region 213 224 N/A INTRINSIC
ZnF_C2H2 239 261 4.4e-2 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176509
SMART Domains Protein: ENSMUSP00000135817
Gene: ENSMUSG00000056459

DomainStartEndE-ValueType
Pfam:BTB 14 65 1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176967
SMART Domains Protein: ENSMUSP00000135434
Gene: ENSMUSG00000056459

DomainStartEndE-ValueType
BTB 24 99 1.06e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220077
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,157,488 E330G possibly damaging Het
Apob A C 12: 8,007,752 D2078A probably benign Het
Arhgap21 T A 2: 20,849,520 Q1681L probably damaging Het
Arsb A G 13: 93,862,101 T306A probably benign Het
Brpf3 G A 17: 28,828,420 D1053N probably damaging Het
Ccdc130 C T 8: 84,263,869 V45I probably benign Het
Cenpf A T 1: 189,652,598 I2495N probably benign Het
Col12a1 T C 9: 79,692,352 K840E possibly damaging Het
Cry1 A G 10: 85,146,755 L269P probably damaging Het
Cyp21a1 C A 17: 34,802,727 E289* probably null Het
Dcp2 A T 18: 44,405,514 K215* probably null Het
Ecm2 A G 13: 49,530,156 N537D probably damaging Het
Emid1 G A 11: 5,135,407 T113M probably benign Het
Exoc8 C T 8: 124,896,179 W483* probably null Het
Fes A T 7: 80,380,283 N582K probably damaging Het
Flnb G T 14: 7,905,507 E1086* probably null Het
Flnc T A 6: 29,455,845 D2058E possibly damaging Het
Gatb G A 3: 85,653,805 D543N probably benign Het
Gm14412 A G 2: 177,317,436 V9A probably damaging Het
Gm4884 T C 7: 41,043,321 V238A possibly damaging Het
Igfbp5 A G 1: 72,873,937 V68A possibly damaging Het
Igflr1 T A 7: 30,567,797 I330N probably damaging Het
Il1r2 A G 1: 40,115,138 T222A probably benign Het
Krt87 T C 15: 101,433,108 E419G probably benign Het
Lman2 A G 13: 55,351,502 S187P probably damaging Het
Lrrc6 A G 15: 66,449,551 I247T probably benign Het
Mrpl38 T C 11: 116,138,462 E76G possibly damaging Het
Mtx3 A G 13: 92,847,604 I130V probably benign Het
Naf1 T G 8: 66,860,536 probably benign Het
Nkx2-1 T G 12: 56,533,508 M216L probably benign Het
Notch1 C A 2: 26,460,007 V2374L probably benign Het
Nrxn2 A G 19: 6,493,007 D1087G probably benign Het
Nudt8 T C 19: 4,001,902 F171S probably damaging Het
Olfr1434 T G 19: 12,283,860 F271V probably benign Het
Pds5a A T 5: 65,628,014 C916* probably null Het
Phyhip A T 14: 70,461,894 N46Y probably damaging Het
Pomt1 A G 2: 32,250,862 Y502C possibly damaging Het
Prkcg A C 7: 3,303,581 probably benign Het
Prl8a6 C T 13: 27,435,386 E118K probably benign Het
Prpf39 T C 12: 65,057,915 probably null Het
Ptprb A G 10: 116,369,357 H2159R probably damaging Het
Ripor2 A T 13: 24,701,612 D571V probably damaging Het
Rps19 C T 7: 24,885,127 L34F probably benign Het
Rusc1 A G 3: 89,088,821 S145P probably damaging Het
Scn4a T A 11: 106,339,225 T586S probably damaging Het
Slc7a12 A G 3: 14,481,064 S90G possibly damaging Het
Specc1l A G 10: 75,246,576 D619G probably damaging Het
Src A G 2: 157,462,790 D143G probably benign Het
Sst T C 16: 23,889,808 N91S probably benign Het
Stxbp5l T A 16: 37,216,036 I406F probably damaging Het
Thsd1 T A 8: 22,258,871 I525N probably damaging Het
Ticam2 A T 18: 46,560,400 F207I probably damaging Het
Tsc22d1 C A 14: 76,418,740 N31K probably damaging Het
Tspan10 T C 11: 120,446,163 V253A probably benign Het
Ttc33 A G 15: 5,208,443 K99R possibly damaging Het
Vmn1r63 T A 7: 5,803,213 N140I probably damaging Het
Zfhx4 T A 3: 5,396,918 C1218S probably damaging Het
Zfp84 T A 7: 29,777,182 I433N probably damaging Het
Other mutations in Zbtb25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Zbtb25 APN 12 76350133 missense probably damaging 0.99
IGL02993:Zbtb25 APN 12 76349417 missense probably damaging 1.00
R1298:Zbtb25 UTSW 12 76350001 missense probably benign 0.01
R1851:Zbtb25 UTSW 12 76349714 missense probably damaging 1.00
R1918:Zbtb25 UTSW 12 76349301 nonsense probably null
R2108:Zbtb25 UTSW 12 76350106 missense probably benign 0.29
R5400:Zbtb25 UTSW 12 76349702 nonsense probably null
R5579:Zbtb25 UTSW 12 76349164 missense possibly damaging 0.94
R7570:Zbtb25 UTSW 12 76369592 unclassified probably benign
R8086:Zbtb25 UTSW 12 76349149 missense probably benign 0.27
R8910:Zbtb25 UTSW 12 76349134 missense probably damaging 1.00
R8965:Zbtb25 UTSW 12 76349803 missense probably benign 0.04
U24488:Zbtb25 UTSW 12 76349240 missense probably benign 0.05
Z1176:Zbtb25 UTSW 12 76349365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTTTACTGATTCTGCAACCTGG -3'
(R):5'- ATAACCGTTGCCAAAGGTTTG -3'

Sequencing Primer
(F):5'- TGATTCTGCAACCTGGAAAAAC -3'
(R):5'- TTGGAAACTCATTGGCCCAG -3'
Posted On 2014-10-15