Incidental Mutation 'R2209:Ripor2'
ID239275
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission 040211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R2209 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24701612 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 571 (D571V)
Ref Sequence ENSEMBL: ENSMUSP00000089286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect probably damaging
Transcript: ENSMUST00000038477
AA Change: D610V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: D610V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058009
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091694
AA Change: D571V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: D571V

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: D585V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: D585V

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: D610V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: D610V

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134370
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,157,488 E330G possibly damaging Het
Apob A C 12: 8,007,752 D2078A probably benign Het
Arhgap21 T A 2: 20,849,520 Q1681L probably damaging Het
Arsb A G 13: 93,862,101 T306A probably benign Het
Brpf3 G A 17: 28,828,420 D1053N probably damaging Het
Ccdc130 C T 8: 84,263,869 V45I probably benign Het
Cenpf A T 1: 189,652,598 I2495N probably benign Het
Col12a1 T C 9: 79,692,352 K840E possibly damaging Het
Cry1 A G 10: 85,146,755 L269P probably damaging Het
Cyp21a1 C A 17: 34,802,727 E289* probably null Het
Dcp2 A T 18: 44,405,514 K215* probably null Het
Ecm2 A G 13: 49,530,156 N537D probably damaging Het
Emid1 G A 11: 5,135,407 T113M probably benign Het
Exoc8 C T 8: 124,896,179 W483* probably null Het
Fes A T 7: 80,380,283 N582K probably damaging Het
Flnb G T 14: 7,905,507 E1086* probably null Het
Flnc T A 6: 29,455,845 D2058E possibly damaging Het
Gatb G A 3: 85,653,805 D543N probably benign Het
Gm14412 A G 2: 177,317,436 V9A probably damaging Het
Gm4884 T C 7: 41,043,321 V238A possibly damaging Het
Igfbp5 A G 1: 72,873,937 V68A possibly damaging Het
Igflr1 T A 7: 30,567,797 I330N probably damaging Het
Il1r2 A G 1: 40,115,138 T222A probably benign Het
Krt87 T C 15: 101,433,108 E419G probably benign Het
Lman2 A G 13: 55,351,502 S187P probably damaging Het
Lrrc6 A G 15: 66,449,551 I247T probably benign Het
Mrpl38 T C 11: 116,138,462 E76G possibly damaging Het
Mtx3 A G 13: 92,847,604 I130V probably benign Het
Naf1 T G 8: 66,860,536 probably benign Het
Nkx2-1 T G 12: 56,533,508 M216L probably benign Het
Notch1 C A 2: 26,460,007 V2374L probably benign Het
Nrxn2 A G 19: 6,493,007 D1087G probably benign Het
Nudt8 T C 19: 4,001,902 F171S probably damaging Het
Olfr1434 T G 19: 12,283,860 F271V probably benign Het
Pds5a A T 5: 65,628,014 C916* probably null Het
Phyhip A T 14: 70,461,894 N46Y probably damaging Het
Pomt1 A G 2: 32,250,862 Y502C possibly damaging Het
Prkcg A C 7: 3,303,581 probably benign Het
Prl8a6 C T 13: 27,435,386 E118K probably benign Het
Prpf39 T C 12: 65,057,915 probably null Het
Ptprb A G 10: 116,369,357 H2159R probably damaging Het
Rps19 C T 7: 24,885,127 L34F probably benign Het
Rusc1 A G 3: 89,088,821 S145P probably damaging Het
Scn4a T A 11: 106,339,225 T586S probably damaging Het
Slc7a12 A G 3: 14,481,064 S90G possibly damaging Het
Specc1l A G 10: 75,246,576 D619G probably damaging Het
Src A G 2: 157,462,790 D143G probably benign Het
Sst T C 16: 23,889,808 N91S probably benign Het
Stxbp5l T A 16: 37,216,036 I406F probably damaging Het
Thsd1 T A 8: 22,258,871 I525N probably damaging Het
Ticam2 A T 18: 46,560,400 F207I probably damaging Het
Tsc22d1 C A 14: 76,418,740 N31K probably damaging Het
Tspan10 T C 11: 120,446,163 V253A probably benign Het
Ttc33 A G 15: 5,208,443 K99R possibly damaging Het
Vmn1r63 T A 7: 5,803,213 N140I probably damaging Het
Zbtb25 A G 12: 76,349,129 *440Q probably null Het
Zfhx4 T A 3: 5,396,918 C1218S probably damaging Het
Zfp84 T A 7: 29,777,182 I433N probably damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8157:Ripor2 UTSW 13 24695617 missense probably benign 0.05
R8364:Ripor2 UTSW 13 24710193 missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24723788 missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24665468 intron probably benign
R8751:Ripor2 UTSW 13 24701067 missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24717668 missense not run
Predicted Primers PCR Primer
(F):5'- AATCGGATGAGGCCTCTGAG -3'
(R):5'- GCAGGTATACACTGGTCCTG -3'

Sequencing Primer
(F):5'- ATGAGGCCTCTGAGCTCAAG -3'
(R):5'- CTTGGTTCAGATCCTGGA -3'
Posted On2014-10-15