Incidental Mutation 'R2209:Sst'
ID239288
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Namesomatostatin
Synonymspreprosomatostatin, Smst, SOM, SRIF
MMRRC Submission 040211-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2209 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location23889573-23890958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23889808 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 91 (N91S)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
Predicted Effect probably benign
Transcript: ENSMUST00000004480
AA Change: N91S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: N91S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,157,488 E330G possibly damaging Het
Apob A C 12: 8,007,752 D2078A probably benign Het
Arhgap21 T A 2: 20,849,520 Q1681L probably damaging Het
Arsb A G 13: 93,862,101 T306A probably benign Het
Brpf3 G A 17: 28,828,420 D1053N probably damaging Het
Ccdc130 C T 8: 84,263,869 V45I probably benign Het
Cenpf A T 1: 189,652,598 I2495N probably benign Het
Col12a1 T C 9: 79,692,352 K840E possibly damaging Het
Cry1 A G 10: 85,146,755 L269P probably damaging Het
Cyp21a1 C A 17: 34,802,727 E289* probably null Het
Dcp2 A T 18: 44,405,514 K215* probably null Het
Ecm2 A G 13: 49,530,156 N537D probably damaging Het
Emid1 G A 11: 5,135,407 T113M probably benign Het
Exoc8 C T 8: 124,896,179 W483* probably null Het
Fes A T 7: 80,380,283 N582K probably damaging Het
Flnb G T 14: 7,905,507 E1086* probably null Het
Flnc T A 6: 29,455,845 D2058E possibly damaging Het
Gatb G A 3: 85,653,805 D543N probably benign Het
Gm14412 A G 2: 177,317,436 V9A probably damaging Het
Gm4884 T C 7: 41,043,321 V238A possibly damaging Het
Igfbp5 A G 1: 72,873,937 V68A possibly damaging Het
Igflr1 T A 7: 30,567,797 I330N probably damaging Het
Il1r2 A G 1: 40,115,138 T222A probably benign Het
Krt87 T C 15: 101,433,108 E419G probably benign Het
Lman2 A G 13: 55,351,502 S187P probably damaging Het
Lrrc6 A G 15: 66,449,551 I247T probably benign Het
Mrpl38 T C 11: 116,138,462 E76G possibly damaging Het
Mtx3 A G 13: 92,847,604 I130V probably benign Het
Naf1 T G 8: 66,860,536 probably benign Het
Nkx2-1 T G 12: 56,533,508 M216L probably benign Het
Notch1 C A 2: 26,460,007 V2374L probably benign Het
Nrxn2 A G 19: 6,493,007 D1087G probably benign Het
Nudt8 T C 19: 4,001,902 F171S probably damaging Het
Olfr1434 T G 19: 12,283,860 F271V probably benign Het
Pds5a A T 5: 65,628,014 C916* probably null Het
Phyhip A T 14: 70,461,894 N46Y probably damaging Het
Pomt1 A G 2: 32,250,862 Y502C possibly damaging Het
Prkcg A C 7: 3,303,581 probably benign Het
Prl8a6 C T 13: 27,435,386 E118K probably benign Het
Prpf39 T C 12: 65,057,915 probably null Het
Ptprb A G 10: 116,369,357 H2159R probably damaging Het
Ripor2 A T 13: 24,701,612 D571V probably damaging Het
Rps19 C T 7: 24,885,127 L34F probably benign Het
Rusc1 A G 3: 89,088,821 S145P probably damaging Het
Scn4a T A 11: 106,339,225 T586S probably damaging Het
Slc7a12 A G 3: 14,481,064 S90G possibly damaging Het
Specc1l A G 10: 75,246,576 D619G probably damaging Het
Src A G 2: 157,462,790 D143G probably benign Het
Stxbp5l T A 16: 37,216,036 I406F probably damaging Het
Thsd1 T A 8: 22,258,871 I525N probably damaging Het
Ticam2 A T 18: 46,560,400 F207I probably damaging Het
Tsc22d1 C A 14: 76,418,740 N31K probably damaging Het
Tspan10 T C 11: 120,446,163 V253A probably benign Het
Ttc33 A G 15: 5,208,443 K99R possibly damaging Het
Vmn1r63 T A 7: 5,803,213 N140I probably damaging Het
Zbtb25 A G 12: 76,349,129 *440Q probably null Het
Zfhx4 T A 3: 5,396,918 C1218S probably damaging Het
Zfp84 T A 7: 29,777,182 I433N probably damaging Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23890698 missense probably benign
R1853:Sst UTSW 16 23890653 missense probably damaging 1.00
R3919:Sst UTSW 16 23889841 missense possibly damaging 0.59
R4350:Sst UTSW 16 23889815 missense probably damaging 0.99
R4351:Sst UTSW 16 23889815 missense probably damaging 0.99
R4352:Sst UTSW 16 23889815 missense probably damaging 0.99
R5586:Sst UTSW 16 23889737 missense probably damaging 1.00
R6844:Sst UTSW 16 23889842 missense probably benign 0.00
R7492:Sst UTSW 16 23889826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGGGTCAAGTTGAGCATC -3'
(R):5'- CCCATATGATTGTGAAAACTGGG -3'

Sequencing Primer
(F):5'- TCAAGTTGAGCATCGGGGGC -3'
(R):5'- CATATGATTGTGAAAACTGGGTTTTG -3'
Posted On2014-10-15