Incidental Mutation 'R2209:Sst'
ID 239288
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Name somatostatin
Synonyms Smst, preprosomatostatin, SRIF, SOM
MMRRC Submission 040211-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2209 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 23708323-23709708 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23708558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 91 (N91S)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
AlphaFold P60041
Predicted Effect probably benign
Transcript: ENSMUST00000004480
AA Change: N91S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: N91S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,884,227 (GRCm39) E330G possibly damaging Het
Apob A C 12: 8,057,752 (GRCm39) D2078A probably benign Het
Arhgap21 T A 2: 20,854,331 (GRCm39) Q1681L probably damaging Het
Arsb A G 13: 93,998,609 (GRCm39) T306A probably benign Het
Brpf3 G A 17: 29,047,394 (GRCm39) D1053N probably damaging Het
Cenpf A T 1: 189,384,795 (GRCm39) I2495N probably benign Het
Col12a1 T C 9: 79,599,634 (GRCm39) K840E possibly damaging Het
Cry1 A G 10: 84,982,619 (GRCm39) L269P probably damaging Het
Cyp21a1 C A 17: 35,021,701 (GRCm39) E289* probably null Het
Dcp2 A T 18: 44,538,581 (GRCm39) K215* probably null Het
Dnaaf11 A G 15: 66,321,400 (GRCm39) I247T probably benign Het
Ecm2 A G 13: 49,683,632 (GRCm39) N537D probably damaging Het
Emid1 G A 11: 5,085,407 (GRCm39) T113M probably benign Het
Exoc8 C T 8: 125,622,918 (GRCm39) W483* probably null Het
Fes A T 7: 80,030,031 (GRCm39) N582K probably damaging Het
Flnb G T 14: 7,905,507 (GRCm38) E1086* probably null Het
Flnc T A 6: 29,455,844 (GRCm39) D2058E possibly damaging Het
Gatb G A 3: 85,561,112 (GRCm39) D543N probably benign Het
Gm14412 A G 2: 177,009,229 (GRCm39) V9A probably damaging Het
Gm4884 T C 7: 40,692,745 (GRCm39) V238A possibly damaging Het
Igfbp5 A G 1: 72,913,096 (GRCm39) V68A possibly damaging Het
Igflr1 T A 7: 30,267,222 (GRCm39) I330N probably damaging Het
Il1r2 A G 1: 40,154,298 (GRCm39) T222A probably benign Het
Krt87 T C 15: 101,330,989 (GRCm39) E419G probably benign Het
Lman2 A G 13: 55,499,315 (GRCm39) S187P probably damaging Het
Mrpl38 T C 11: 116,029,288 (GRCm39) E76G possibly damaging Het
Mtx3 A G 13: 92,984,112 (GRCm39) I130V probably benign Het
Naf1 T G 8: 67,313,188 (GRCm39) probably benign Het
Nkx2-1 T G 12: 56,580,293 (GRCm39) M216L probably benign Het
Notch1 C A 2: 26,350,019 (GRCm39) V2374L probably benign Het
Nrxn2 A G 19: 6,543,037 (GRCm39) D1087G probably benign Het
Nudt8 T C 19: 4,051,902 (GRCm39) F171S probably damaging Het
Or5an1 T G 19: 12,261,224 (GRCm39) F271V probably benign Het
Pds5a A T 5: 65,785,357 (GRCm39) C916* probably null Het
Phyhip A T 14: 70,699,334 (GRCm39) N46Y probably damaging Het
Pomt1 A G 2: 32,140,874 (GRCm39) Y502C possibly damaging Het
Prkcg A C 7: 3,352,097 (GRCm39) probably benign Het
Prl8a6 C T 13: 27,619,369 (GRCm39) E118K probably benign Het
Prpf39 T C 12: 65,104,689 (GRCm39) probably null Het
Ptprb A G 10: 116,205,262 (GRCm39) H2159R probably damaging Het
Ripor2 A T 13: 24,885,595 (GRCm39) D571V probably damaging Het
Rps19 C T 7: 24,584,552 (GRCm39) L34F probably benign Het
Rusc1 A G 3: 88,996,128 (GRCm39) S145P probably damaging Het
Scn4a T A 11: 106,230,051 (GRCm39) T586S probably damaging Het
Slc7a12 A G 3: 14,546,124 (GRCm39) S90G possibly damaging Het
Specc1l A G 10: 75,082,410 (GRCm39) D619G probably damaging Het
Src A G 2: 157,304,710 (GRCm39) D143G probably benign Het
Stxbp5l T A 16: 37,036,398 (GRCm39) I406F probably damaging Het
Thsd1 T A 8: 22,748,887 (GRCm39) I525N probably damaging Het
Ticam2 A T 18: 46,693,467 (GRCm39) F207I probably damaging Het
Tsc22d1 C A 14: 76,656,180 (GRCm39) N31K probably damaging Het
Tspan10 T C 11: 120,336,989 (GRCm39) V253A probably benign Het
Ttc33 A G 15: 5,237,924 (GRCm39) K99R possibly damaging Het
Vmn1r63 T A 7: 5,806,212 (GRCm39) N140I probably damaging Het
Yju2b C T 8: 84,990,498 (GRCm39) V45I probably benign Het
Zbtb25 A G 12: 76,395,903 (GRCm39) *440Q probably null Het
Zfhx4 T A 3: 5,461,978 (GRCm39) C1218S probably damaging Het
Zfp84 T A 7: 29,476,607 (GRCm39) I433N probably damaging Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23,709,448 (GRCm39) missense probably benign
R1853:Sst UTSW 16 23,709,403 (GRCm39) missense probably damaging 1.00
R3919:Sst UTSW 16 23,708,591 (GRCm39) missense possibly damaging 0.59
R4350:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R4351:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R4352:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R5586:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
R6844:Sst UTSW 16 23,708,592 (GRCm39) missense probably benign 0.00
R7492:Sst UTSW 16 23,708,576 (GRCm39) missense probably damaging 1.00
R8903:Sst UTSW 16 23,708,499 (GRCm39) nonsense probably null
R9417:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGGGTCAAGTTGAGCATC -3'
(R):5'- CCCATATGATTGTGAAAACTGGG -3'

Sequencing Primer
(F):5'- TCAAGTTGAGCATCGGGGGC -3'
(R):5'- CATATGATTGTGAAAACTGGGTTTTG -3'
Posted On 2014-10-15