Incidental Mutation 'R2209:Dcp2'
ID239293
Institutional Source Beutler Lab
Gene Symbol Dcp2
Ensembl Gene ENSMUSG00000024472
Gene Namedecapping mRNA 2
Synonyms
MMRRC Submission 040211-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R2209 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location44380502-44424969 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44405514 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 215 (K215*)
Ref Sequence ENSEMBL: ENSMUSP00000025350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025350]
Predicted Effect probably null
Transcript: ENSMUST00000025350
AA Change: K215*
SMART Domains Protein: ENSMUSP00000025350
Gene: ENSMUSG00000024472
AA Change: K215*

DomainStartEndE-ValueType
DCP2 10 94 4.23e-50 SMART
Pfam:NUDIX 97 219 6.5e-17 PFAM
low complexity region 240 258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,157,488 E330G possibly damaging Het
Apob A C 12: 8,007,752 D2078A probably benign Het
Arhgap21 T A 2: 20,849,520 Q1681L probably damaging Het
Arsb A G 13: 93,862,101 T306A probably benign Het
Brpf3 G A 17: 28,828,420 D1053N probably damaging Het
Ccdc130 C T 8: 84,263,869 V45I probably benign Het
Cenpf A T 1: 189,652,598 I2495N probably benign Het
Col12a1 T C 9: 79,692,352 K840E possibly damaging Het
Cry1 A G 10: 85,146,755 L269P probably damaging Het
Cyp21a1 C A 17: 34,802,727 E289* probably null Het
Ecm2 A G 13: 49,530,156 N537D probably damaging Het
Emid1 G A 11: 5,135,407 T113M probably benign Het
Exoc8 C T 8: 124,896,179 W483* probably null Het
Fes A T 7: 80,380,283 N582K probably damaging Het
Flnb G T 14: 7,905,507 E1086* probably null Het
Flnc T A 6: 29,455,845 D2058E possibly damaging Het
Gatb G A 3: 85,653,805 D543N probably benign Het
Gm14412 A G 2: 177,317,436 V9A probably damaging Het
Gm4884 T C 7: 41,043,321 V238A possibly damaging Het
Igfbp5 A G 1: 72,873,937 V68A possibly damaging Het
Igflr1 T A 7: 30,567,797 I330N probably damaging Het
Il1r2 A G 1: 40,115,138 T222A probably benign Het
Krt87 T C 15: 101,433,108 E419G probably benign Het
Lman2 A G 13: 55,351,502 S187P probably damaging Het
Lrrc6 A G 15: 66,449,551 I247T probably benign Het
Mrpl38 T C 11: 116,138,462 E76G possibly damaging Het
Mtx3 A G 13: 92,847,604 I130V probably benign Het
Naf1 T G 8: 66,860,536 probably benign Het
Nkx2-1 T G 12: 56,533,508 M216L probably benign Het
Notch1 C A 2: 26,460,007 V2374L probably benign Het
Nrxn2 A G 19: 6,493,007 D1087G probably benign Het
Nudt8 T C 19: 4,001,902 F171S probably damaging Het
Olfr1434 T G 19: 12,283,860 F271V probably benign Het
Pds5a A T 5: 65,628,014 C916* probably null Het
Phyhip A T 14: 70,461,894 N46Y probably damaging Het
Pomt1 A G 2: 32,250,862 Y502C possibly damaging Het
Prkcg A C 7: 3,303,581 probably benign Het
Prl8a6 C T 13: 27,435,386 E118K probably benign Het
Prpf39 T C 12: 65,057,915 probably null Het
Ptprb A G 10: 116,369,357 H2159R probably damaging Het
Ripor2 A T 13: 24,701,612 D571V probably damaging Het
Rps19 C T 7: 24,885,127 L34F probably benign Het
Rusc1 A G 3: 89,088,821 S145P probably damaging Het
Scn4a T A 11: 106,339,225 T586S probably damaging Het
Slc7a12 A G 3: 14,481,064 S90G possibly damaging Het
Specc1l A G 10: 75,246,576 D619G probably damaging Het
Src A G 2: 157,462,790 D143G probably benign Het
Sst T C 16: 23,889,808 N91S probably benign Het
Stxbp5l T A 16: 37,216,036 I406F probably damaging Het
Thsd1 T A 8: 22,258,871 I525N probably damaging Het
Ticam2 A T 18: 46,560,400 F207I probably damaging Het
Tsc22d1 C A 14: 76,418,740 N31K probably damaging Het
Tspan10 T C 11: 120,446,163 V253A probably benign Het
Ttc33 A G 15: 5,208,443 K99R possibly damaging Het
Vmn1r63 T A 7: 5,803,213 N140I probably damaging Het
Zbtb25 A G 12: 76,349,129 *440Q probably null Het
Zfhx4 T A 3: 5,396,918 C1218S probably damaging Het
Zfp84 T A 7: 29,777,182 I433N probably damaging Het
Other mutations in Dcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02801:Dcp2 APN 18 44417711 missense probably damaging 1.00
belay UTSW 18 44395952 missense probably damaging 0.99
PIT4431001:Dcp2 UTSW 18 44412571 missense probably benign 0.15
R0051:Dcp2 UTSW 18 44405374 splice site probably benign
R0515:Dcp2 UTSW 18 44399731 missense probably benign 0.41
R0761:Dcp2 UTSW 18 44410233 missense probably benign 0.01
R1696:Dcp2 UTSW 18 44400324 missense probably damaging 1.00
R1803:Dcp2 UTSW 18 44395917 missense probably damaging 1.00
R1928:Dcp2 UTSW 18 44405571 critical splice donor site probably null
R1964:Dcp2 UTSW 18 44395971 missense possibly damaging 0.50
R2014:Dcp2 UTSW 18 44410296 missense probably benign 0.00
R4167:Dcp2 UTSW 18 44395967 missense probably damaging 1.00
R4668:Dcp2 UTSW 18 44415362 splice site probably null
R4877:Dcp2 UTSW 18 44417592 missense probably benign 0.11
R5147:Dcp2 UTSW 18 44417595 nonsense probably null
R5559:Dcp2 UTSW 18 44405487 missense probably damaging 1.00
R6533:Dcp2 UTSW 18 44399664 missense probably benign 0.25
R7406:Dcp2 UTSW 18 44410187 missense probably benign 0.00
R7469:Dcp2 UTSW 18 44395952 missense probably damaging 0.99
R7850:Dcp2 UTSW 18 44400348 nonsense probably null
R7933:Dcp2 UTSW 18 44400348 nonsense probably null
R8054:Dcp2 UTSW 18 44405707 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTTGCTCGCTTGTACATC -3'
(R):5'- TCTCCAAATCTTCGAGACAGC -3'

Sequencing Primer
(F):5'- CGCTTGTACATCATTCCAGGAG -3'
(R):5'- GACAGCCAGTCCCTTAGTG -3'
Posted On2014-10-15