Incidental Mutation 'R2209:Olfr1434'
ID 239297
Institutional Source Beutler Lab
Gene Symbol Olfr1434
Ensembl Gene ENSMUSG00000095640
Gene Name olfactory receptor 1434
Synonyms MOR214-4, Olfr1433, MOR214-4, GA_x6K02T2RE5P-2618516-2619454, GA_x6K02T2RE5P-2610001-2610414
MMRRC Submission 040211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R2209 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12279854-12285626 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12283860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 271 (F271V)
Ref Sequence ENSEMBL: ENSMUSP00000146411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207186] [ENSMUST00000207915] [ENSMUST00000208197]
AlphaFold Q7TQR9
Predicted Effect probably benign
Transcript: ENSMUST00000087814
AA Change: F271V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085115
Gene: ENSMUSG00000095640
AA Change: F271V

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 9.2e-55 PFAM
Pfam:7tm_1 42 307 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207186
AA Change: F271V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000207915
Predicted Effect probably benign
Transcript: ENSMUST00000208197
AA Change: F271V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,157,488 E330G possibly damaging Het
Apob A C 12: 8,007,752 D2078A probably benign Het
Arhgap21 T A 2: 20,849,520 Q1681L probably damaging Het
Arsb A G 13: 93,862,101 T306A probably benign Het
Brpf3 G A 17: 28,828,420 D1053N probably damaging Het
Ccdc130 C T 8: 84,263,869 V45I probably benign Het
Cenpf A T 1: 189,652,598 I2495N probably benign Het
Col12a1 T C 9: 79,692,352 K840E possibly damaging Het
Cry1 A G 10: 85,146,755 L269P probably damaging Het
Cyp21a1 C A 17: 34,802,727 E289* probably null Het
Dcp2 A T 18: 44,405,514 K215* probably null Het
Ecm2 A G 13: 49,530,156 N537D probably damaging Het
Emid1 G A 11: 5,135,407 T113M probably benign Het
Exoc8 C T 8: 124,896,179 W483* probably null Het
Fes A T 7: 80,380,283 N582K probably damaging Het
Flnb G T 14: 7,905,507 E1086* probably null Het
Flnc T A 6: 29,455,845 D2058E possibly damaging Het
Gatb G A 3: 85,653,805 D543N probably benign Het
Gm14412 A G 2: 177,317,436 V9A probably damaging Het
Gm4884 T C 7: 41,043,321 V238A possibly damaging Het
Igfbp5 A G 1: 72,873,937 V68A possibly damaging Het
Igflr1 T A 7: 30,567,797 I330N probably damaging Het
Il1r2 A G 1: 40,115,138 T222A probably benign Het
Krt87 T C 15: 101,433,108 E419G probably benign Het
Lman2 A G 13: 55,351,502 S187P probably damaging Het
Lrrc6 A G 15: 66,449,551 I247T probably benign Het
Mrpl38 T C 11: 116,138,462 E76G possibly damaging Het
Mtx3 A G 13: 92,847,604 I130V probably benign Het
Naf1 T G 8: 66,860,536 probably benign Het
Nkx2-1 T G 12: 56,533,508 M216L probably benign Het
Notch1 C A 2: 26,460,007 V2374L probably benign Het
Nrxn2 A G 19: 6,493,007 D1087G probably benign Het
Nudt8 T C 19: 4,001,902 F171S probably damaging Het
Pds5a A T 5: 65,628,014 C916* probably null Het
Phyhip A T 14: 70,461,894 N46Y probably damaging Het
Pomt1 A G 2: 32,250,862 Y502C possibly damaging Het
Prkcg A C 7: 3,303,581 probably benign Het
Prl8a6 C T 13: 27,435,386 E118K probably benign Het
Prpf39 T C 12: 65,057,915 probably null Het
Ptprb A G 10: 116,369,357 H2159R probably damaging Het
Ripor2 A T 13: 24,701,612 D571V probably damaging Het
Rps19 C T 7: 24,885,127 L34F probably benign Het
Rusc1 A G 3: 89,088,821 S145P probably damaging Het
Scn4a T A 11: 106,339,225 T586S probably damaging Het
Slc7a12 A G 3: 14,481,064 S90G possibly damaging Het
Specc1l A G 10: 75,246,576 D619G probably damaging Het
Src A G 2: 157,462,790 D143G probably benign Het
Sst T C 16: 23,889,808 N91S probably benign Het
Stxbp5l T A 16: 37,216,036 I406F probably damaging Het
Thsd1 T A 8: 22,258,871 I525N probably damaging Het
Ticam2 A T 18: 46,560,400 F207I probably damaging Het
Tsc22d1 C A 14: 76,418,740 N31K probably damaging Het
Tspan10 T C 11: 120,446,163 V253A probably benign Het
Ttc33 A G 15: 5,208,443 K99R possibly damaging Het
Vmn1r63 T A 7: 5,803,213 N140I probably damaging Het
Zbtb25 A G 12: 76,349,129 *440Q probably null Het
Zfhx4 T A 3: 5,396,918 C1218S probably damaging Het
Zfp84 T A 7: 29,777,182 I433N probably damaging Het
Other mutations in Olfr1434
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Olfr1434 APN 19 12283705 missense probably damaging 1.00
IGL02415:Olfr1434 APN 19 12283498 missense probably benign 0.44
IGL02731:Olfr1434 APN 19 12283842 missense probably damaging 0.99
IGL02803:Olfr1434 APN 19 12283983 missense possibly damaging 0.94
IGL03050:Olfr1434 UTSW 19 12283512 missense probably benign
R0432:Olfr1434 UTSW 19 12283903 missense probably damaging 1.00
R3710:Olfr1434 UTSW 19 12283086 missense probably damaging 1.00
R4724:Olfr1434 UTSW 19 12283096 missense probably damaging 1.00
R5133:Olfr1434 UTSW 19 12283306 missense possibly damaging 0.96
R5974:Olfr1434 UTSW 19 12283836 missense probably damaging 1.00
R6544:Olfr1434 UTSW 19 12283155 missense probably damaging 1.00
R7225:Olfr1434 UTSW 19 12283467 missense probably benign 0.00
R7320:Olfr1434 UTSW 19 12283816 missense possibly damaging 0.72
R7467:Olfr1434 UTSW 19 12283475 nonsense probably null
R7900:Olfr1434 UTSW 19 12283341 missense probably damaging 1.00
R8719:Olfr1434 UTSW 19 12283428 missense probably benign 0.13
R9135:Olfr1434 UTSW 19 12283444 missense probably damaging 1.00
R9324:Olfr1434 UTSW 19 12283575 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACGCCTTAGCCATCATGGTG -3'
(R):5'- GCCATGGACTTTGTAGTATTCCAGC -3'

Sequencing Primer
(F):5'- AGCCATCATGGTGTCCTATG -3'
(R):5'- TGTAGTATTCCAGCCATGTGTAC -3'
Posted On 2014-10-15