Incidental Mutation 'R2210:Pramef17'
ID239304
Institutional Source Beutler Lab
Gene Symbol Pramef17
Ensembl Gene ENSMUSG00000078509
Gene NamePRAME family member 17
SynonymsGm13107
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143991119-143994369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143994219 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 51 (M51L)
Ref Sequence ENSEMBL: ENSMUSP00000101388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105762]
Predicted Effect probably benign
Transcript: ENSMUST00000105762
AA Change: M51L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101388
Gene: ENSMUSG00000078509
AA Change: M51L

DomainStartEndE-ValueType
low complexity region 188 200 N/A INTRINSIC
SCOP:d1a4ya_ 205 408 5e-11 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Pramef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Pramef17 APN 4 143993324 missense probably benign 0.01
IGL01981:Pramef17 APN 4 143994354 missense probably damaging 1.00
IGL02322:Pramef17 APN 4 143992021 splice site probably benign
IGL02514:Pramef17 APN 4 143993202 missense probably benign 0.12
IGL02806:Pramef17 APN 4 143992931 splice site probably null
IGL02888:Pramef17 APN 4 143994099 missense probably benign 0.42
IGL03032:Pramef17 APN 4 143993245 missense probably damaging 1.00
R0269:Pramef17 UTSW 4 143993518 splice site probably benign
R0363:Pramef17 UTSW 4 143991651 missense probably benign 0.01
R0617:Pramef17 UTSW 4 143993518 splice site probably benign
R1456:Pramef17 UTSW 4 143993281 missense probably benign
R1475:Pramef17 UTSW 4 143994312 missense probably benign 0.00
R1724:Pramef17 UTSW 4 143993432 missense probably benign 0.00
R2158:Pramef17 UTSW 4 143994315 missense possibly damaging 0.65
R3834:Pramef17 UTSW 4 143994226 missense probably benign 0.01
R4438:Pramef17 UTSW 4 143991622 missense probably damaging 1.00
R5152:Pramef17 UTSW 4 143994260 missense probably damaging 0.97
R5832:Pramef17 UTSW 4 143991962 missense probably damaging 0.98
R6809:Pramef17 UTSW 4 143993081 missense probably benign 0.01
R6986:Pramef17 UTSW 4 143993318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCTTTCCAGGCCCCTATAG -3'
(R):5'- TCTCCCTAAAGATCCATCAGAATG -3'

Sequencing Primer
(F):5'- AGGCCCCTATAGGTCTCTGAGAC -3'
(R):5'- TCAGAATGGACTTGGAAGCCCC -3'
Posted On2014-10-15