Incidental Mutation 'R2210:Dgkq'
ID239306
Institutional Source Beutler Lab
Gene Symbol Dgkq
Ensembl Gene ENSMUSG00000004815
Gene Namediacylglycerol kinase, theta
Synonyms110kDa, DAGK7, Dagk4, Dgkd, Dgk theta
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108646693-108669672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108660523 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 58 (R58L)
Ref Sequence ENSEMBL: ENSMUSP00000118065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053913] [ENSMUST00000071650] [ENSMUST00000132179] [ENSMUST00000132708] [ENSMUST00000153238]
Predicted Effect probably damaging
Transcript: ENSMUST00000053913
AA Change: R58L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815
AA Change: R58L

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071650
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132179
AA Change: R58L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118466
Gene: ENSMUSG00000004815
AA Change: R58L

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144624
Predicted Effect probably damaging
Transcript: ENSMUST00000153238
AA Change: R58L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118065
Gene: ENSMUSG00000004815
AA Change: R58L

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153365
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Dgkq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dgkq APN 5 108654582 missense possibly damaging 0.72
IGL02364:Dgkq APN 5 108656444 missense probably benign 0.05
IGL02966:Dgkq APN 5 108656421 splice site probably null
IGL03297:Dgkq APN 5 108650274 missense probably damaging 1.00
R0179:Dgkq UTSW 5 108658200 splice site probably benign
R0194:Dgkq UTSW 5 108654644 intron probably benign
R0332:Dgkq UTSW 5 108655099 splice site probably benign
R0513:Dgkq UTSW 5 108656495 missense probably benign 0.02
R0525:Dgkq UTSW 5 108654615 missense probably damaging 1.00
R0673:Dgkq UTSW 5 108655589 missense probably damaging 0.97
R0801:Dgkq UTSW 5 108660720 utr 5 prime probably null
R0850:Dgkq UTSW 5 108654578 missense possibly damaging 0.82
R0944:Dgkq UTSW 5 108656465 missense probably damaging 1.00
R1069:Dgkq UTSW 5 108656037 splice site probably benign
R1411:Dgkq UTSW 5 108650362 missense probably damaging 1.00
R1488:Dgkq UTSW 5 108650877 missense probably damaging 1.00
R1858:Dgkq UTSW 5 108653731 missense probably benign 0.00
R1874:Dgkq UTSW 5 108660595 missense probably benign 0.07
R4499:Dgkq UTSW 5 108649661 missense possibly damaging 0.54
R5061:Dgkq UTSW 5 108654123 missense probably benign 0.02
R5474:Dgkq UTSW 5 108649143 critical splice donor site probably null
R5481:Dgkq UTSW 5 108648810 unclassified probably null
R5951:Dgkq UTSW 5 108654370 missense probably damaging 1.00
R6193:Dgkq UTSW 5 108655500 nonsense probably null
R6429:Dgkq UTSW 5 108653708 missense probably damaging 1.00
R6458:Dgkq UTSW 5 108654376 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGTCCTACTCAAACCAGAGTCTGTC -3'
(R):5'- CTTTATCGTGCGCTTGGAGC -3'

Sequencing Primer
(F):5'- GAGTCTGTCTCTGTGCCCAC -3'
(R):5'- TTGGAGCTGGGGCGCTC -3'
Posted On2014-10-15