Incidental Mutation 'R2210:2210016L21Rik'
List |< first << previous [record 8 of 1826] next >> last >|
ID239307
Institutional Source Beutler Lab
Gene Symbol 2210016L21Rik
Ensembl Gene ENSMUSG00000029559
Gene NameRIKEN cDNA 2210016L21 gene
Synonyms
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R2210 (G1)
Quality Score200
Status Not validated
Chromosome5
Chromosomal Location114942158-114949783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 114942289 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 28 (R28G)
Ref Sequence ENSEMBL: ENSMUSP00000031538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031538] [ENSMUST00000031540] [ENSMUST00000112143]
Predicted Effect probably damaging
Transcript: ENSMUST00000031538
AA Change: R28G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031538
Gene: ENSMUSG00000029559
AA Change: R28G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 40 52 N/A INTRINSIC
low complexity region 150 158 N/A INTRINSIC
low complexity region 182 206 N/A INTRINSIC
low complexity region 229 237 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031540
SMART Domains Protein: ENSMUSP00000031540
Gene: ENSMUSG00000041827

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
Pfam:OAS1_C 162 348 8e-76 PFAM
UBQ 350 425 1.58e0 SMART
UBQ 430 501 2.22e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112143
SMART Domains Protein: ENSMUSP00000107771
Gene: ENSMUSG00000041827

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
Pfam:OAS1_C 163 346 1.9e-79 PFAM
UBQ 350 425 1.58e0 SMART
UBQ 430 501 2.22e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131427
AA Change: R27G
Predicted Effect probably benign
Transcript: ENSMUST00000131771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155274
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I460F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 I380T probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D117G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in 2210016L21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:2210016L21Rik APN 5 114947177 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CCAATGGTGGTCTGGGAACTAC -3'
(R):5'- GTCAGGAGGCATTTAGGTGC -3'

Sequencing Primer
(F):5'- TGGTCTGGGAACTACAATTCC -3'
(R):5'- GTGTCAGTGTGATCCCCAAAAGATC -3'
Posted OnOct 15, 2014