Incidental Mutation 'R2210:Lmtk2'
ID 239308
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Name lemur tyrosine kinase 2
Synonyms BREK, AATYK2, A330101P12Rik, KPI2, KPI-2, 2900041G10Rik, cprk
MMRRC Submission 040212-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R2210 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 144037254-144125022 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144084427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 154 (E154G)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
AlphaFold Q3TYD6
Predicted Effect probably damaging
Transcript: ENSMUST00000041804
AA Change: E154G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: E154G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 115,080,348 (GRCm39) R28G probably damaging Het
Adgrb1 C T 15: 74,419,553 (GRCm39) A798V probably damaging Het
Ash1l G T 3: 88,973,605 (GRCm39) D2555Y probably damaging Het
Atr G A 9: 95,789,353 (GRCm39) R1503Q probably damaging Het
Cbln3 T A 14: 56,121,383 (GRCm39) I88F possibly damaging Het
Cct7 G A 6: 85,436,212 (GRCm39) G41D probably damaging Het
Cd1d2 G T 3: 86,895,041 (GRCm39) A138S possibly damaging Het
Dct T C 14: 118,280,561 (GRCm39) I152V probably benign Het
Dgkq C A 5: 108,808,389 (GRCm39) R58L probably damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Gm4884 A T 7: 40,692,970 (GRCm39) E313V possibly damaging Het
Hectd1 A T 12: 51,853,245 (GRCm39) I92K probably damaging Het
Icam1 A G 9: 20,930,329 (GRCm39) E61G probably damaging Het
Itgb2l C T 16: 96,227,421 (GRCm39) V541M possibly damaging Het
Majin C A 19: 6,272,728 (GRCm39) H223N possibly damaging Het
Mc4r A T 18: 66,992,466 (GRCm39) F216I probably damaging Het
Muc4 AG AGG 16: 32,755,176 (GRCm38) probably null Het
Obscn A T 11: 58,958,913 (GRCm39) V3379D probably damaging Het
Or8g30 A T 9: 39,230,089 (GRCm39) S274T probably damaging Het
Pde4b A T 4: 102,454,672 (GRCm39) N346I probably damaging Het
Pitpnm1 T C 19: 4,155,253 (GRCm39) S331P probably damaging Het
Plcb2 T A 2: 118,547,984 (GRCm39) I437F probably damaging Het
Pramel14 T A 4: 143,720,789 (GRCm39) M51L probably benign Het
Prr12 A G 7: 44,698,775 (GRCm39) probably benign Het
Pus7l T G 15: 94,438,173 (GRCm39) D224A possibly damaging Het
Sh3pxd2a A G 19: 47,255,782 (GRCm39) S1007P possibly damaging Het
Stac G A 9: 111,431,638 (GRCm39) P238S probably damaging Het
Tmem107 A G 11: 68,962,096 (GRCm39) E45G possibly damaging Het
Tmt1b T A 10: 128,794,591 (GRCm39) K244N probably damaging Het
Triml2 T C 8: 43,636,397 (GRCm39) Y61H probably damaging Het
Uba2 T C 7: 33,862,587 (GRCm39) D95G probably damaging Het
Ube2d3 T A 3: 135,168,802 (GRCm39) D132E probably benign Het
Unc5d A G 8: 29,251,825 (GRCm39) I216T probably damaging Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144,070,973 (GRCm39) missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144,111,512 (GRCm39) missense probably benign
IGL00848:Lmtk2 APN 5 144,113,216 (GRCm39) missense probably benign
IGL01450:Lmtk2 APN 5 144,111,520 (GRCm39) missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144,112,753 (GRCm39) nonsense probably null
IGL01967:Lmtk2 APN 5 144,119,597 (GRCm39) missense probably benign
IGL01998:Lmtk2 APN 5 144,112,883 (GRCm39) missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144,112,769 (GRCm39) missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144,093,754 (GRCm39) missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144,085,166 (GRCm39) missense probably damaging 1.00
madagascar UTSW 5 144,111,737 (GRCm39) missense probably benign 0.02
A4554:Lmtk2 UTSW 5 144,103,135 (GRCm39) missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144,103,205 (GRCm39) missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144,103,205 (GRCm39) missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144,111,103 (GRCm39) missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144,111,103 (GRCm39) missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144,111,809 (GRCm39) missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144,111,407 (GRCm39) missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144,110,680 (GRCm39) missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144,110,993 (GRCm39) missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144,111,928 (GRCm39) missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144,084,433 (GRCm39) missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144,084,433 (GRCm39) missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144,112,924 (GRCm39) missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144,110,444 (GRCm39) missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144,110,729 (GRCm39) missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144,103,245 (GRCm39) splice site probably benign
R4011:Lmtk2 UTSW 5 144,112,697 (GRCm39) missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144,120,044 (GRCm39) missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144,084,482 (GRCm39) missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144,111,599 (GRCm39) missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144,111,752 (GRCm39) missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144,113,265 (GRCm39) missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144,093,718 (GRCm39) missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144,111,656 (GRCm39) missense probably benign
R6083:Lmtk2 UTSW 5 144,119,574 (GRCm39) missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144,112,160 (GRCm39) missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144,111,404 (GRCm39) missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144,110,624 (GRCm39) missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144,111,503 (GRCm39) missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144,111,737 (GRCm39) missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144,085,175 (GRCm39) missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144,110,615 (GRCm39) missense probably damaging 1.00
R7286:Lmtk2 UTSW 5 144,111,178 (GRCm39) nonsense probably null
R7390:Lmtk2 UTSW 5 144,066,261 (GRCm39) missense possibly damaging 0.79
R7594:Lmtk2 UTSW 5 144,110,564 (GRCm39) missense probably damaging 1.00
R7660:Lmtk2 UTSW 5 144,085,158 (GRCm39) missense probably damaging 1.00
R7785:Lmtk2 UTSW 5 144,111,571 (GRCm39) missense probably benign 0.00
R7977:Lmtk2 UTSW 5 144,111,959 (GRCm39) missense probably benign 0.02
R7987:Lmtk2 UTSW 5 144,111,959 (GRCm39) missense probably benign 0.02
R8089:Lmtk2 UTSW 5 144,093,718 (GRCm39) missense probably benign 0.07
R8138:Lmtk2 UTSW 5 144,112,415 (GRCm39) missense probably damaging 0.99
R8694:Lmtk2 UTSW 5 144,108,566 (GRCm39) missense probably damaging 1.00
R8714:Lmtk2 UTSW 5 144,112,876 (GRCm39) missense probably damaging 1.00
R8816:Lmtk2 UTSW 5 144,112,793 (GRCm39) nonsense probably null
R8845:Lmtk2 UTSW 5 144,110,704 (GRCm39) missense probably damaging 1.00
R8856:Lmtk2 UTSW 5 144,113,079 (GRCm39) missense probably damaging 1.00
R9306:Lmtk2 UTSW 5 144,119,599 (GRCm39) missense probably benign 0.17
R9494:Lmtk2 UTSW 5 144,037,338 (GRCm39) start gained probably benign
X0024:Lmtk2 UTSW 5 144,111,068 (GRCm39) missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144,119,669 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGTGTGGGTTCCATACATTCTC -3'
(R):5'- TCTGAACTGACATGAGGCCG -3'

Sequencing Primer
(F):5'- TCTGTCATACCCATGTGAGCAGAG -3'
(R):5'- AACTGACATGAGGCCGCTTTG -3'
Posted On 2014-10-15