Incidental Mutation 'R2210:Cct7'
ID239309
Institutional Source Beutler Lab
Gene Symbol Cct7
Ensembl Gene ENSMUSG00000030007
Gene Namechaperonin containing Tcp1, subunit 7 (eta)
SynonymsCctz, Ccth
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85451514-85468475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85459230 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 41 (G41D)
Ref Sequence ENSEMBL: ENSMUSP00000144893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032078] [ENSMUST00000204489] [ENSMUST00000204592]
Predicted Effect probably damaging
Transcript: ENSMUST00000032078
AA Change: G41D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032078
Gene: ENSMUSG00000030007
AA Change: G41D

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 524 1.8e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204489
AA Change: G41D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144919
Gene: ENSMUSG00000030007
AA Change: G41D

DomainStartEndE-ValueType
PDB:4B2T|H 1 53 2e-29 PDB
Blast:VWA 5 51 4e-7 BLAST
SCOP:d1a6da1 16 51 2e-8 SMART
low complexity region 68 80 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204592
AA Change: G41D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144893
Gene: ENSMUSG00000030007
AA Change: G41D

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 91 6e-21 PFAM
Pfam:Cpn60_TCP1 88 482 5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205143
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Cct7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02223:Cct7 APN 6 85462041 missense probably benign 0.00
IGL02292:Cct7 APN 6 85461109 missense probably benign 0.03
IGL02724:Cct7 APN 6 85459149 missense probably damaging 1.00
IGL02740:Cct7 APN 6 85468270 missense probably benign
R0184:Cct7 UTSW 6 85461554 missense probably null 0.55
R1363:Cct7 UTSW 6 85466035 missense probably damaging 1.00
R1378:Cct7 UTSW 6 85467563 intron probably null
R2076:Cct7 UTSW 6 85468140 missense probably damaging 0.98
R3905:Cct7 UTSW 6 85466708 missense possibly damaging 0.90
R4298:Cct7 UTSW 6 85468173 missense probably damaging 1.00
R4422:Cct7 UTSW 6 85467145 missense probably damaging 0.98
R6519:Cct7 UTSW 6 85462150 missense probably benign 0.19
R6903:Cct7 UTSW 6 85466693 missense probably benign 0.27
R6925:Cct7 UTSW 6 85459182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGGTATTGGGAGCATC -3'
(R):5'- CACAGATCCCAACAGGGTTC -3'

Sequencing Primer
(F):5'- GGTATTGGGAGCATCTTCCCC -3'
(R):5'- CCAACAGGGTTCTGCATTCAAGG -3'
Posted On2014-10-15