Incidental Mutation 'R0183:Clec16a'
ID23931
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
MMRRC Submission 038448-MU
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0183 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10560022 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 28 (Y28H)
Ref Sequence ENSEMBL: ENSMUSP00000123189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000150894] [ENSMUST00000155633]
Predicted Effect probably damaging
Transcript: ENSMUST00000038145
AA Change: Y28H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663
AA Change: Y28H

DomainStartEndE-ValueType
Pfam:FPL 51 199 9.2e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
low complexity region 897 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066345
AA Change: Y28H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: Y28H

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115824
AA Change: Y28H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: Y28H

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115827
AA Change: Y28H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663
AA Change: Y28H

DomainStartEndE-ValueType
Pfam:FPL 51 199 8.7e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115828
AA Change: Y28H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663
AA Change: Y28H

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130148
Predicted Effect probably benign
Transcript: ENSMUST00000150894
SMART Domains Protein: ENSMUSP00000114577
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155633
AA Change: Y28H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: Y28H

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Meta Mutation Damage Score 0.9310 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0268:Clec16a UTSW 16 10644828 nonsense probably null
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0556:Clec16a UTSW 16 10638785 critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2269:Clec16a UTSW 16 10644786 missense probably damaging 1.00
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5329:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 unclassified probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R6894:Clec16a UTSW 16 10644854 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTGTCCCTGGCATGTAATGCCTC -3'
(R):5'- ACTCTTCTTGCCCTGGAGCAGATG -3'

Sequencing Primer
(F):5'- TGGCATGTAATGCCTCAGAGC -3'
(R):5'- GGCTCAACTTGGAATGTTATCCAC -3'
Posted On2013-04-16