Incidental Mutation 'R2210:Uba2'
ID239311
Institutional Source Beutler Lab
Gene Symbol Uba2
Ensembl Gene ENSMUSG00000052997
Gene Nameubiquitin-like modifier activating enzyme 2
SynonymsUble1b, Sumo-1 activating enzyme subunit 2, anthracycline-associated resistance, Arx, UBA2, SAE2
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.976) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location34140688-34169599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34163162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 95 (D95G)
Ref Sequence ENSEMBL: ENSMUSP00000116605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102746] [ENSMUST00000156253] [ENSMUST00000175991]
Predicted Effect probably damaging
Transcript: ENSMUST00000102746
AA Change: D117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099807
Gene: ENSMUSG00000052997
AA Change: D117G

DomainStartEndE-ValueType
Pfam:ThiF 3 442 5.8e-77 PFAM
Pfam:UAE_UbL 450 537 5.6e-27 PFAM
Pfam:UBA2_C 547 634 8.9e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000134856
AA Change: D30G
Predicted Effect probably damaging
Transcript: ENSMUST00000156253
AA Change: D95G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116605
Gene: ENSMUSG00000052997
AA Change: D95G

DomainStartEndE-ValueType
Pfam:ThiF 10 119 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175991
SMART Domains Protein: ENSMUSP00000135885
Gene: ENSMUSG00000052997

DomainStartEndE-ValueType
Pfam:UBA_e1_thiolCys 31 75 5.3e-26 PFAM
low complexity region 88 105 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206651
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 (MIM 613294) and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Uba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Uba2 APN 7 34158869 missense probably damaging 1.00
IGL01593:Uba2 APN 7 34146264 missense probably damaging 0.96
IGL02268:Uba2 APN 7 34142736 critical splice donor site probably null
IGL03399:Uba2 APN 7 34144514 missense probably damaging 1.00
R0242:Uba2 UTSW 7 34154629 missense possibly damaging 0.92
R0242:Uba2 UTSW 7 34154629 missense possibly damaging 0.92
R0270:Uba2 UTSW 7 34150856 missense possibly damaging 0.95
R0390:Uba2 UTSW 7 34151021 missense probably benign 0.10
R0603:Uba2 UTSW 7 34161613 missense probably damaging 1.00
R1066:Uba2 UTSW 7 34158822 missense probably damaging 1.00
R1806:Uba2 UTSW 7 34163199 missense probably damaging 0.99
R1813:Uba2 UTSW 7 34151030 missense probably damaging 1.00
R1896:Uba2 UTSW 7 34151030 missense probably damaging 1.00
R3618:Uba2 UTSW 7 34154482 critical splice donor site probably null
R3779:Uba2 UTSW 7 34154646 critical splice acceptor site probably null
R3793:Uba2 UTSW 7 34146297 missense probably damaging 0.97
R4607:Uba2 UTSW 7 34154596 missense probably damaging 1.00
R4608:Uba2 UTSW 7 34154596 missense probably damaging 1.00
R5938:Uba2 UTSW 7 34165490 splice site probably null
R6404:Uba2 UTSW 7 34154560 missense probably damaging 0.98
X0026:Uba2 UTSW 7 34154479 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCACCTGTGAAGATTTGGC -3'
(R):5'- TGTTAAGACAACCCCAGCCTTC -3'

Sequencing Primer
(F):5'- GCTATCCTGGAACTCTGTAGACCAG -3'
(R):5'- GTATCTATATGGCATATACTCCCACC -3'
Posted On2014-10-15