Incidental Mutation 'R2210:Emc10'
ID239313
Institutional Source Beutler Lab
Gene Symbol Emc10
Ensembl Gene ENSMUSG00000008140
Gene NameER membrane protein complex subunit 10
Synonyms
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44489937-44496529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44493192 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 109 (R109W)
Ref Sequence ENSEMBL: ENSMUSP00000116293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000118515] [ENSMUST00000118808] [ENSMUST00000138328] [ENSMUST00000205359] [ENSMUST00000205422] [ENSMUST00000206398]
Predicted Effect probably damaging
Transcript: ENSMUST00000008284
AA Change: R109W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008284
Gene: ENSMUSG00000008140
AA Change: R109W

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 256 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107927
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118515
AA Change: R109W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113141
Gene: ENSMUSG00000008140
AA Change: R109W

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118808
AA Change: R109W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113509
Gene: ENSMUSG00000008140
AA Change: R109W

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
low complexity region 246 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123928
Predicted Effect probably damaging
Transcript: ENSMUST00000138328
AA Change: R109W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116293
Gene: ENSMUSG00000008140
AA Change: R109W

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150342
Predicted Effect probably benign
Transcript: ENSMUST00000205359
Predicted Effect probably benign
Transcript: ENSMUST00000205422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206195
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206965
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a gene trapped allele display improved glucose tolerance and reduced fertility, while female homozygotes exhibit an increased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Emc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03102:Emc10 APN 7 44491989 missense probably damaging 1.00
R2016:Emc10 UTSW 7 44493192 missense probably damaging 1.00
R2211:Emc10 UTSW 7 44493192 missense probably damaging 1.00
R2902:Emc10 UTSW 7 44493192 missense probably damaging 1.00
R3104:Emc10 UTSW 7 44493192 missense probably damaging 1.00
R3106:Emc10 UTSW 7 44493192 missense probably damaging 1.00
R4840:Emc10 UTSW 7 44492627 missense probably damaging 1.00
R4967:Emc10 UTSW 7 44493188 critical splice donor site probably null
R5294:Emc10 UTSW 7 44496439 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCAAACCACGTTTCCCTGAC -3'
(R):5'- AGTCAGGCACTTGTGACAG -3'

Sequencing Primer
(F):5'- TCCCTCAAACTGGGCAGAAG -3'
(R):5'- TCAGGCACTTGTGACAGCTAGG -3'
Posted On2014-10-15