Incidental Mutation 'R2210:Icam1'
ID239319
Institutional Source Beutler Lab
Gene Symbol Icam1
Ensembl Gene ENSMUSG00000037405
Gene Nameintercellular adhesion molecule 1
SynonymsCD54, Icam-1, Ly-47, MALA-2
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21015985-21028817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21019033 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 61 (E61G)
Ref Sequence ENSEMBL: ENSMUSP00000083587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086399]
Predicted Effect probably damaging
Transcript: ENSMUST00000086399
AA Change: E61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083587
Gene: ENSMUSG00000037405
AA Change: E61G

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
IG_like 33 109 5.91e1 SMART
IG_like 119 208 1.15e2 SMART
IG 319 396 1.49e-2 SMART
IG 407 479 3.91e-6 SMART
transmembrane domain 486 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215003
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that binds leukocyte adhesion protein LFA-1. It participates in the innate immune response. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired inflammatory and immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Icam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Icam1 APN 9 21016105 splice site probably null
IGL01652:Icam1 APN 9 21019176 missense probably damaging 1.00
R0458:Icam1 UTSW 9 21027861 unclassified probably null
R0709:Icam1 UTSW 9 21019127 missense probably damaging 0.98
R1102:Icam1 UTSW 9 21027836 missense possibly damaging 0.83
R1473:Icam1 UTSW 9 21027876 missense probably damaging 1.00
R4362:Icam1 UTSW 9 21026312 missense possibly damaging 0.62
R5350:Icam1 UTSW 9 21027886 nonsense probably null
R6835:Icam1 UTSW 9 21027125 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GAAGTCACAGGGATAACCAAACTTC -3'
(R):5'- GAGATCTCTAAGTGACTGTGGGAC -3'

Sequencing Primer
(F):5'- GGGATAACCAAACTTCCTCTCATCTC -3'
(R):5'- GTCATGTGCCCAGTGAGTCTC -3'
Posted On2014-10-15