Incidental Mutation 'R0184:Ints8'
ID 23932
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Name integrator complex subunit 8
Synonyms 2810013E07Rik, D130008D20Rik
MMRRC Submission 038449-MU
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R0184 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 4
Chromosomal Location 11199158-11254258 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 11218637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 797 (S797A)
Ref Sequence ENSEMBL: ENSMUSP00000103955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
AlphaFold Q80V86
Predicted Effect probably benign
Transcript: ENSMUST00000044616
AA Change: S797A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: S797A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108318
AA Change: S797A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: S797A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108319
AA Change: S797A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: S797A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145252
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11246120 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0540:Ints8 UTSW 4 11252926 missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1503:Ints8 UTSW 4 11245842 missense probably damaging 0.97
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1757:Ints8 UTSW 4 11254109 start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5206:Ints8 UTSW 4 11216477 missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5505:Ints8 UTSW 4 11221143 missense probably benign 0.18
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11204474 missense probably damaging 1.00
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11225613 missense probably benign 0.01
R7772:Ints8 UTSW 4 11227190 missense probably damaging 0.97
R7872:Ints8 UTSW 4 11254062 missense probably benign 0.00
R7953:Ints8 UTSW 4 11227128 missense probably benign
R8184:Ints8 UTSW 4 11204534 missense probably damaging 1.00
R8301:Ints8 UTSW 4 11246120 missense probably damaging 1.00
R8708:Ints8 UTSW 4 11208824 critical splice donor site probably null
R8868:Ints8 UTSW 4 11230488 missense probably benign
R9245:Ints8 UTSW 4 11213811 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCACAGCACTACAAGAGATCTGTAGGG -3'
(R):5'- AGCTTCACAATGTTCGGGTCAGTATC -3'

Sequencing Primer
(F):5'- atccgcctgcctctgtc -3'
(R):5'- GTTCGGGTCAGTATCTTGTAATTTC -3'
Posted On 2013-04-16