Incidental Mutation 'R0184:Ints8'
ID 23932
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Name integrator complex subunit 8
Synonyms 2810013E07Rik, D130008D20Rik
MMRRC Submission 038449-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R0184 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 4
Chromosomal Location 11199158-11254258 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 11218637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 797 (S797A)
Ref Sequence ENSEMBL: ENSMUSP00000103955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
AlphaFold Q80V86
Predicted Effect probably benign
Transcript: ENSMUST00000044616
AA Change: S797A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: S797A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108318
AA Change: S797A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: S797A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108319
AA Change: S797A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: S797A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145252
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,212,899 (GRCm39) V131F probably damaging Het
Adam28 T C 14: 68,874,822 (GRCm39) D285G probably benign Het
Akr1c13 A G 13: 4,244,055 (GRCm39) E36G probably damaging Het
Antxr2 A G 5: 98,127,889 (GRCm39) L214S probably damaging Het
Arhgap26 T A 18: 38,750,726 (GRCm39) D46E unknown Het
Armc9 T C 1: 86,126,092 (GRCm39) L61P probably damaging Het
Bicc1 C A 10: 70,915,045 (GRCm39) R73L probably benign Het
Calm2 T C 17: 87,743,269 (GRCm39) N43S probably benign Het
Cct7 A G 6: 85,438,536 (GRCm39) D105G probably null Het
Cdk18 T C 1: 132,046,276 (GRCm39) N215D probably benign Het
Cep126 T C 9: 8,103,396 (GRCm39) T205A probably benign Het
Cfap57 A T 4: 118,456,209 (GRCm39) I495N probably damaging Het
Cyp2b9 T A 7: 25,886,432 (GRCm39) C152* probably null Het
Dab2ip G A 2: 35,608,803 (GRCm39) R579H probably damaging Het
Dnah8 T C 17: 30,902,657 (GRCm39) V905A probably benign Het
Eif4h C A 5: 134,654,229 (GRCm39) D134Y possibly damaging Het
Espl1 T A 15: 102,207,651 (GRCm39) S372T probably benign Het
Fat2 T A 11: 55,187,114 (GRCm39) H1244L probably damaging Het
Fbxo11 T A 17: 88,316,101 (GRCm39) N443I probably benign Het
Git2 G A 5: 114,877,098 (GRCm39) T128M possibly damaging Het
Gm10985 T A 3: 53,752,679 (GRCm39) Y21N probably damaging Het
Gm12790 A T 4: 101,824,811 (GRCm39) Y152* probably null Het
Heatr5a T C 12: 51,956,752 (GRCm39) D1115G probably benign Het
Hipk2 T C 6: 38,695,866 (GRCm39) N726S possibly damaging Het
Hrg T C 16: 22,772,521 (GRCm39) probably null Het
Iars1 T G 13: 49,875,688 (GRCm39) S792A probably benign Het
Igf1r A G 7: 67,875,941 (GRCm39) N1301S possibly damaging Het
Il22 A T 10: 118,041,511 (GRCm39) I75F probably damaging Het
Ilkap T C 1: 91,304,027 (GRCm39) probably benign Het
Ints13 A T 6: 146,456,542 (GRCm39) Y435N probably benign Het
Itgad T A 7: 127,788,403 (GRCm39) D405E probably benign Het
Itgam A T 7: 127,685,230 (GRCm39) I448F probably damaging Het
Klk1 C T 7: 43,878,173 (GRCm39) T41I possibly damaging Het
Mcrip1 T C 11: 120,435,710 (GRCm39) M1V probably null Het
Mdga1 A G 17: 30,071,416 (GRCm39) Y128H probably damaging Het
Mtor G T 4: 148,549,428 (GRCm39) R604L probably benign Het
Or52p1 T C 7: 104,267,447 (GRCm39) V187A probably damaging Het
Or5d41 A T 2: 88,055,124 (GRCm39) L84* probably null Het
Pcdhb7 T A 18: 37,476,443 (GRCm39) D526E probably benign Het
Pip4k2a T C 2: 18,893,939 (GRCm39) D139G probably damaging Het
Pkp3 A C 7: 140,668,280 (GRCm39) N536T probably benign Het
Pla2g4c T A 7: 13,090,145 (GRCm39) S524T probably benign Het
Pno1 T C 11: 17,161,127 (GRCm39) E69G probably benign Het
Pold1 C T 7: 44,191,139 (GRCm39) V231M probably benign Het
Poli A G 18: 70,655,802 (GRCm39) S248P probably damaging Het
Ppox C T 1: 171,107,126 (GRCm39) S138N probably damaging Het
Psg20 T C 7: 18,419,901 (GRCm39) E6G probably null Het
Rbmx C T X: 56,436,926 (GRCm39) probably null Het
Rln1 T A 19: 29,309,336 (GRCm39) K148* probably null Het
Rnf213 C T 11: 119,305,347 (GRCm39) T526I probably damaging Het
Rps6kc1 A T 1: 190,531,290 (GRCm39) V904E probably null Het
Sf3b2 T A 19: 5,333,700 (GRCm39) I633F probably damaging Het
Sfswap T A 5: 129,584,253 (GRCm39) I189N probably damaging Het
Smarca2 T A 19: 26,669,649 (GRCm39) Y973* probably null Het
Spink5 G A 18: 44,136,265 (GRCm39) D559N probably benign Het
Spty2d1 C T 7: 46,647,322 (GRCm39) V536I possibly damaging Het
Tbx3 T C 5: 119,813,627 (GRCm39) I221T probably damaging Het
Tcf20 T A 15: 82,736,501 (GRCm39) D1650V probably damaging Het
Thsd7b A G 1: 129,358,701 (GRCm39) K45R probably benign Het
Tirap A G 9: 35,100,490 (GRCm39) S65P probably benign Het
Trim25 C T 11: 88,890,466 (GRCm39) P51L probably damaging Het
Trim61 T C 8: 65,467,069 (GRCm39) N64S probably benign Het
Twf1 T A 15: 94,478,948 (GRCm39) probably null Het
Ubr4 A C 4: 139,172,573 (GRCm39) T1692P probably damaging Het
Usp3 A G 9: 66,469,863 (GRCm39) M86T probably damaging Het
Utrn T C 10: 12,543,362 (GRCm39) D1762G probably benign Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Vmn2r52 T C 7: 9,893,265 (GRCm39) S625G probably damaging Het
Vmn2r90 G A 17: 17,947,139 (GRCm39) W472* probably null Het
Vrk2 C A 11: 26,500,046 (GRCm39) A56S probably damaging Het
Yeats2 C T 16: 20,022,435 (GRCm39) P620S possibly damaging Het
Zbtb21 C T 16: 97,751,713 (GRCm39) D171N probably damaging Het
Zeb1 A T 18: 5,766,808 (GRCm39) I440F probably damaging Het
Zfp292 A G 4: 34,819,563 (GRCm39) I253T probably damaging Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11,218,679 (GRCm39) splice site probably benign
IGL01925:Ints8 APN 4 11,235,617 (GRCm39) splice site probably benign
IGL02195:Ints8 APN 4 11,221,222 (GRCm39) missense probably damaging 1.00
IGL02215:Ints8 APN 4 11,209,244 (GRCm39) missense probably damaging 1.00
IGL02429:Ints8 APN 4 11,231,720 (GRCm39) missense probably damaging 1.00
IGL02484:Ints8 APN 4 11,208,834 (GRCm39) nonsense probably null
IGL02558:Ints8 APN 4 11,218,771 (GRCm39) missense probably damaging 1.00
IGL02725:Ints8 APN 4 11,239,406 (GRCm39) missense probably benign 0.01
IGL02742:Ints8 APN 4 11,241,627 (GRCm39) missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11,245,896 (GRCm39) missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11,235,565 (GRCm39) missense probably damaging 1.00
IGL03171:Ints8 APN 4 11,231,702 (GRCm39) missense probably benign 0.01
IGL03335:Ints8 APN 4 11,216,460 (GRCm39) missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
P0026:Ints8 UTSW 4 11,225,788 (GRCm39) nonsense probably null
R0054:Ints8 UTSW 4 11,204,595 (GRCm39) utr 3 prime probably benign
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0299:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0499:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0540:Ints8 UTSW 4 11,252,926 (GRCm39) missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R1232:Ints8 UTSW 4 11,234,587 (GRCm39) missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11,221,204 (GRCm39) missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11,239,461 (GRCm39) missense probably benign 0.22
R1503:Ints8 UTSW 4 11,245,842 (GRCm39) missense probably damaging 0.97
R1587:Ints8 UTSW 4 11,245,722 (GRCm39) critical splice donor site probably null
R1701:Ints8 UTSW 4 11,231,656 (GRCm39) missense probably damaging 1.00
R1721:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1757:Ints8 UTSW 4 11,254,109 (GRCm39) start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11,225,600 (GRCm39) critical splice donor site probably null
R1867:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1868:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1952:Ints8 UTSW 4 11,221,150 (GRCm39) missense probably benign 0.21
R2084:Ints8 UTSW 4 11,230,377 (GRCm39) missense probably benign 0.31
R2108:Ints8 UTSW 4 11,235,552 (GRCm39) missense probably damaging 0.99
R2202:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11,225,725 (GRCm39) missense probably benign 0.29
R2504:Ints8 UTSW 4 11,241,642 (GRCm39) missense probably benign 0.03
R3824:Ints8 UTSW 4 11,225,621 (GRCm39) nonsense probably null
R4664:Ints8 UTSW 4 11,227,152 (GRCm39) missense probably benign 0.04
R4703:Ints8 UTSW 4 11,223,785 (GRCm39) missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11,230,367 (GRCm39) nonsense probably null
R5206:Ints8 UTSW 4 11,216,477 (GRCm39) missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11,211,916 (GRCm39) missense probably damaging 1.00
R5505:Ints8 UTSW 4 11,221,143 (GRCm39) missense probably benign 0.18
R5513:Ints8 UTSW 4 11,248,303 (GRCm39) missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11,241,654 (GRCm39) missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11,223,813 (GRCm39) missense probably damaging 1.00
R6007:Ints8 UTSW 4 11,208,845 (GRCm39) missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11,252,891 (GRCm39) missense probably damaging 1.00
R6466:Ints8 UTSW 4 11,252,878 (GRCm39) missense probably damaging 0.99
R6709:Ints8 UTSW 4 11,221,117 (GRCm39) missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11,204,474 (GRCm39) missense probably damaging 1.00
R6998:Ints8 UTSW 4 11,204,537 (GRCm39) missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11,204,574 (GRCm39) missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11,225,613 (GRCm39) missense probably benign 0.01
R7772:Ints8 UTSW 4 11,227,190 (GRCm39) missense probably damaging 0.97
R7872:Ints8 UTSW 4 11,254,062 (GRCm39) missense probably benign 0.00
R7953:Ints8 UTSW 4 11,227,128 (GRCm39) missense probably benign
R8184:Ints8 UTSW 4 11,204,534 (GRCm39) missense probably damaging 1.00
R8301:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
R8708:Ints8 UTSW 4 11,208,824 (GRCm39) critical splice donor site probably null
R8868:Ints8 UTSW 4 11,230,488 (GRCm39) missense probably benign
R9245:Ints8 UTSW 4 11,213,811 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCACAGCACTACAAGAGATCTGTAGGG -3'
(R):5'- AGCTTCACAATGTTCGGGTCAGTATC -3'

Sequencing Primer
(F):5'- atccgcctgcctctgtc -3'
(R):5'- GTTCGGGTCAGTATCTTGTAATTTC -3'
Posted On 2013-04-16