Incidental Mutation 'R2210:Olfr948'
ID239320
Institutional Source Beutler Lab
Gene Symbol Olfr948
Ensembl Gene ENSMUSG00000057349
Gene Nameolfactory receptor 948
SynonymsMOR171-45, GA_x6K02T2PVTD-33016899-33015934, MOR171-51
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39315712-39326045 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39318793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 274 (S274T)
Ref Sequence ENSEMBL: ENSMUSP00000149422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076516] [ENSMUST00000216132]
Predicted Effect probably damaging
Transcript: ENSMUST00000076516
AA Change: S274T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075834
Gene: ENSMUSG00000057349
AA Change: S274T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-49 PFAM
Pfam:7tm_1 41 290 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216132
AA Change: S274T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Olfr948
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Olfr948 APN 9 39318832 nonsense probably null
IGL02297:Olfr948 APN 9 39318703 missense possibly damaging 0.64
IGL02678:Olfr948 APN 9 39318921 missense probably benign 0.01
IGL03182:Olfr948 APN 9 39318981 missense probably benign 0.16
R0116:Olfr948 UTSW 9 39318864 missense probably damaging 1.00
R0152:Olfr948 UTSW 9 39319461 missense probably benign 0.32
R0227:Olfr948 UTSW 9 39318678 missense probably benign 0.00
R0317:Olfr948 UTSW 9 39319461 missense probably benign 0.32
R2151:Olfr948 UTSW 9 39319117 missense probably damaging 0.97
R2974:Olfr948 UTSW 9 39318996 missense probably damaging 1.00
R4716:Olfr948 UTSW 9 39319429 missense probably benign 0.22
R4886:Olfr948 UTSW 9 39319585 missense probably benign 0.01
R5058:Olfr948 UTSW 9 39318664 missense probably benign
R5339:Olfr948 UTSW 9 39319303 missense possibly damaging 0.94
R6431:Olfr948 UTSW 9 39318778 missense possibly damaging 0.50
R6736:Olfr948 UTSW 9 39318793 missense probably damaging 1.00
R6902:Olfr948 UTSW 9 39319019 missense probably damaging 1.00
R6946:Olfr948 UTSW 9 39319019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCACATTGTTCATTCTGAG -3'
(R):5'- ATCTGTGTCCCAATGCTGACTG -3'

Sequencing Primer
(F):5'- GCCCACATTGTTCATTCTGAGAAATG -3'
(R):5'- GTGTCCCAATGCTGACTGTTATTAC -3'
Posted On2014-10-15