Incidental Mutation 'R2210:Stac'
ID239322
Institutional Source Beutler Lab
Gene Symbol Stac
Ensembl Gene ENSMUSG00000032502
Gene Namesrc homology three (SH3) and cysteine rich domain
Synonyms
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111561437-111690348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111602570 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 238 (P238S)
Ref Sequence ENSEMBL: ENSMUSP00000035083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035083] [ENSMUST00000161995]
Predicted Effect probably damaging
Transcript: ENSMUST00000035083
AA Change: P238S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035083
Gene: ENSMUSG00000032502
AA Change: P238S

DomainStartEndE-ValueType
low complexity region 78 93 N/A INTRINSIC
C1 109 160 5.91e-13 SMART
low complexity region 213 232 N/A INTRINSIC
SH3 289 344 3.45e-20 SMART
Pfam:SH3_2 349 401 6.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161995
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Stac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Stac APN 9 111635039 missense probably damaging 1.00
IGL01870:Stac APN 9 111572332 missense probably benign 0.22
IGL02999:Stac APN 9 111604130 missense probably damaging 1.00
IGL03004:Stac APN 9 111602540 missense probably benign 0.00
R0240:Stac UTSW 9 111635021 missense probably damaging 0.99
R0240:Stac UTSW 9 111635021 missense probably damaging 0.99
R1777:Stac UTSW 9 111604082 missense possibly damaging 0.94
R2237:Stac UTSW 9 111690122 start gained probably benign
R2238:Stac UTSW 9 111690122 start gained probably benign
R2239:Stac UTSW 9 111690122 start gained probably benign
R4125:Stac UTSW 9 111604058 critical splice donor site probably null
R4126:Stac UTSW 9 111604058 critical splice donor site probably null
R4128:Stac UTSW 9 111604058 critical splice donor site probably null
X0057:Stac UTSW 9 111572333 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAAGCATTCTTATGGCCAGGAC -3'
(R):5'- GGTTGTGTATGCCCCTTAACC -3'

Sequencing Primer
(F):5'- TATGGCCAGGACTCTTGACCATG -3'
(R):5'- ATGCCCCTTAACCTGTGAATCAATG -3'
Posted On2014-10-15