Incidental Mutation 'R2210:Mettl7b'
ID239324
Institutional Source Beutler Lab
Gene Symbol Mettl7b
Ensembl Gene ENSMUSG00000025347
Gene Namemethyltransferase like 7B
Synonyms
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128958274-128960988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128958722 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 244 (K244N)
Ref Sequence ENSEMBL: ENSMUSP00000026398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026398] [ENSMUST00000099112] [ENSMUST00000218290]
Predicted Effect probably damaging
Transcript: ENSMUST00000026398
AA Change: K244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026398
Gene: ENSMUSG00000025347
AA Change: K244N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ubie_methyltran 40 193 2.8e-9 PFAM
Pfam:Methyltransf_23 43 222 5.5e-20 PFAM
Pfam:Methyltransf_31 68 225 1.6e-15 PFAM
Pfam:Methyltransf_18 71 175 4.6e-10 PFAM
Pfam:Methyltransf_25 74 168 2.3e-10 PFAM
Pfam:Methyltransf_12 75 170 8.8e-16 PFAM
Pfam:Methyltransf_11 75 172 1.9e-22 PFAM
Pfam:Methyltransf_8 120 192 3.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099112
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218290
Predicted Effect probably benign
Transcript: ENSMUST00000219427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219897
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Mettl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Mettl7b APN 10 128958862 missense probably benign 0.00
IGL02157:Mettl7b APN 10 128960617 missense possibly damaging 0.82
R1392:Mettl7b UTSW 10 128960698 missense possibly damaging 0.90
R1392:Mettl7b UTSW 10 128960698 missense possibly damaging 0.90
R4684:Mettl7b UTSW 10 128960702 nonsense probably null
R5075:Mettl7b UTSW 10 128960680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAGGGCTTAGCAGTGTAG -3'
(R):5'- ACTGTTCTTCTGGGAGCACG -3'

Sequencing Primer
(F):5'- GTTTTCTGTCTCTAGTGGCCGAAAC -3'
(R):5'- TGAGCCTCAGGGAAGCC -3'
Posted On2014-10-15