Incidental Mutation 'R0183:Igf2bp2'
Institutional Source Beutler Lab
Gene Symbol Igf2bp2
Ensembl Gene ENSMUSG00000033581
Gene Nameinsulin-like growth factor 2 mRNA binding protein 2
SynonymsIMP-2, C330012H03Rik
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R0183 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location22059009-22163299 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22078730 bp
Amino Acid Change Tyrosine to Stop codon at position 244 (Y244*)
Ref Sequence ENSEMBL: ENSMUSP00000111037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100052] [ENSMUST00000115379]
Predicted Effect probably null
Transcript: ENSMUST00000100052
AA Change: Y312*
SMART Domains Protein: ENSMUSP00000097629
Gene: ENSMUSG00000033581
AA Change: Y312*

RRM 4 72 8.2e-11 SMART
RRM 83 153 4.07e-6 SMART
KH 185 256 1.28e-14 SMART
KH 266 339 1.97e-15 SMART
low complexity region 375 391 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
KH 419 490 1.1e-13 SMART
KH 501 573 2.48e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115379
AA Change: Y244*
SMART Domains Protein: ENSMUSP00000111037
Gene: ENSMUSG00000033581
AA Change: Y244*

RRM 15 85 4.07e-6 SMART
KH 117 188 1.28e-14 SMART
KH 198 271 1.97e-15 SMART
low complexity region 307 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
KH 351 422 1.1e-13 SMART
KH 433 505 2.48e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231926
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the 5' UTR of insulin-like growth factor 2 (IGF2) mRNA and regulates its translation. It plays an important role in metabolism and variation in this gene is associated with susceptibility to diabetes. Alternative splicing and promoter usage results in multiple transcript variants. Related pseudogenes are found on several chromosomes. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Igf2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Igf2bp2 APN 16 22063704 missense probably damaging 1.00
IGL02374:Igf2bp2 APN 16 22081868 missense probably benign 0.00
IGL02752:Igf2bp2 APN 16 22080110 missense probably benign 0.00
IGL02884:Igf2bp2 APN 16 22162885 missense probably benign 0.00
IGL03072:Igf2bp2 APN 16 22068141 critical splice donor site probably null
defender UTSW 16 22070306 critical splice donor site probably null
Petite UTSW 16 22079608 critical splice acceptor site probably null
R0008:Igf2bp2 UTSW 16 22076091 missense probably benign 0.22
R0390:Igf2bp2 UTSW 16 22081801 missense possibly damaging 0.87
R0505:Igf2bp2 UTSW 16 22089099 missense possibly damaging 0.90
R0610:Igf2bp2 UTSW 16 22070309 missense probably benign 0.00
R0696:Igf2bp2 UTSW 16 22080125 missense probably benign 0.19
R0966:Igf2bp2 UTSW 16 22089090 missense probably damaging 1.00
R1101:Igf2bp2 UTSW 16 22162950 missense probably damaging 1.00
R1159:Igf2bp2 UTSW 16 22061853 splice site probably benign
R1169:Igf2bp2 UTSW 16 22078730 nonsense probably null
R1762:Igf2bp2 UTSW 16 22083947 nonsense probably null
R2168:Igf2bp2 UTSW 16 22079608 critical splice acceptor site probably null
R4014:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4015:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4016:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4017:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4128:Igf2bp2 UTSW 16 22078621 missense probably benign 0.00
R4986:Igf2bp2 UTSW 16 22070306 critical splice donor site probably null
R5007:Igf2bp2 UTSW 16 22079496 missense probably damaging 1.00
R5268:Igf2bp2 UTSW 16 22079491 missense probably damaging 1.00
R5531:Igf2bp2 UTSW 16 22089085 missense probably damaging 1.00
R6154:Igf2bp2 UTSW 16 22076093 nonsense probably null
R6819:Igf2bp2 UTSW 16 22060836 missense probably damaging 1.00
R6975:Igf2bp2 UTSW 16 22061861 missense probably null 1.00
R7008:Igf2bp2 UTSW 16 22081832 missense probably benign 0.16
R7311:Igf2bp2 UTSW 16 22061882 missense possibly damaging 0.76
R8011:Igf2bp2 UTSW 16 22076099 missense probably damaging 1.00
R8045:Igf2bp2 UTSW 16 22083978 missense possibly damaging 0.82
R8442:Igf2bp2 UTSW 16 22065091 critical splice donor site probably null
X0066:Igf2bp2 UTSW 16 22161291 missense probably benign 0.15
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gccagggctatacagagaaac -3'
Posted On2013-04-16