Incidental Mutation 'R2210:Itgb2l'
ID239335
Institutional Source Beutler Lab
Gene Symbol Itgb2l
Ensembl Gene ENSMUSG00000000157
Gene Nameintegrin beta 2-like
Synonymspactolus, 5033406G21Rik
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location96422288-96443619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96426221 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 541 (V541M)
Ref Sequence ENSEMBL: ENSMUSP00000000161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113794] [ENSMUST00000113795] [ENSMUST00000131567] [ENSMUST00000136292]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000161
AA Change: V541M

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: V541M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113773
AA Change: V541M

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: V541M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113794
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000131567
SMART Domains Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131777
Predicted Effect probably benign
Transcript: ENSMUST00000136292
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Itgb2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Itgb2l APN 16 96426750 missense probably damaging 0.98
IGL01482:Itgb2l APN 16 96438748 missense probably damaging 0.99
IGL01767:Itgb2l APN 16 96430575 missense probably benign 0.05
IGL02056:Itgb2l APN 16 96427689 missense probably damaging 0.97
IGL02072:Itgb2l APN 16 96430608 missense probably benign
IGL02858:Itgb2l APN 16 96422650 missense possibly damaging 0.96
R0011:Itgb2l UTSW 16 96427661 splice site probably benign
R0153:Itgb2l UTSW 16 96437369 missense possibly damaging 0.94
R0270:Itgb2l UTSW 16 96422930 unclassified probably benign
R0496:Itgb2l UTSW 16 96434701 missense possibly damaging 0.86
R0627:Itgb2l UTSW 16 96422911 unclassified probably benign
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1509:Itgb2l UTSW 16 96426849 missense probably benign 0.28
R1792:Itgb2l UTSW 16 96425082 missense probably damaging 1.00
R1912:Itgb2l UTSW 16 96426935 missense probably benign 0.17
R3160:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3162:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3836:Itgb2l UTSW 16 96426167 missense probably benign
R4131:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4132:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4254:Itgb2l UTSW 16 96430577 missense probably benign 0.00
R4854:Itgb2l UTSW 16 96426117 nonsense probably null
R4893:Itgb2l UTSW 16 96427821 missense probably benign 0.12
R4931:Itgb2l UTSW 16 96437449 missense probably damaging 1.00
R5039:Itgb2l UTSW 16 96425005 missense possibly damaging 0.69
R5055:Itgb2l UTSW 16 96427803 missense probably damaging 1.00
R5960:Itgb2l UTSW 16 96426259 missense probably benign 0.00
R6412:Itgb2l UTSW 16 96427729 missense probably benign 0.04
R6966:Itgb2l UTSW 16 96430643 missense probably benign 0.02
X0018:Itgb2l UTSW 16 96435676 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGGGTTGTAGGGACACTCAC -3'
(R):5'- CCCATCTATCCTTGCAAGGTG -3'

Sequencing Primer
(F):5'- TGTAGGGACACTCACTAGTACTCG -3'
(R):5'- CCATCTATCCTTGCAAGGTGTTGTG -3'
Posted On2014-10-15