Incidental Mutation 'R2210:Sh3pxd2a'
ID239340
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2a
Ensembl Gene ENSMUSG00000053617
Gene NameSH3 and PX domains 2A
SynonymsTks5, Fish, Sh3md1, 2310014D11Rik
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47260174-47464411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47267343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1007 (S1007P)
Ref Sequence ENSEMBL: ENSMUSP00000080325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081619
AA Change: S1007P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: S1007P

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
low complexity region 242 254 N/A INTRINSIC
SH3 269 324 6.49e-16 SMART
low complexity region 360 371 N/A INTRINSIC
SH3 450 505 4.49e-10 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 654 676 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
SH3 836 891 2.41e-10 SMART
SH3 1066 1124 3.85e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111800
AA Change: S979P

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: S979P

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
SH3 241 296 6.49e-16 SMART
low complexity region 332 343 N/A INTRINSIC
SH3 422 477 4.49e-10 SMART
low complexity region 491 509 N/A INTRINSIC
low complexity region 604 624 N/A INTRINSIC
low complexity region 626 648 N/A INTRINSIC
low complexity region 657 681 N/A INTRINSIC
SH3 808 863 2.41e-10 SMART
SH3 1038 1096 3.85e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Sh3pxd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Sh3pxd2a APN 19 47314155 missense probably benign 0.20
IGL01606:Sh3pxd2a APN 19 47268596 missense probably benign
IGL02001:Sh3pxd2a APN 19 47273447 missense probably damaging 0.99
IGL02060:Sh3pxd2a APN 19 47373378 splice site probably benign
IGL02830:Sh3pxd2a APN 19 47283078 missense probably damaging 1.00
IGL03240:Sh3pxd2a APN 19 47268026 missense probably damaging 1.00
IGL03263:Sh3pxd2a APN 19 47314043 missense probably damaging 1.00
IGL03290:Sh3pxd2a APN 19 47424516 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0504:Sh3pxd2a UTSW 19 47267747 missense probably damaging 1.00
R0683:Sh3pxd2a UTSW 19 47267511 missense probably benign 0.04
R0726:Sh3pxd2a UTSW 19 47268762 missense probably damaging 1.00
R0883:Sh3pxd2a UTSW 19 47268207 missense probably damaging 1.00
R1276:Sh3pxd2a UTSW 19 47268383 missense probably benign
R1349:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1372:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1525:Sh3pxd2a UTSW 19 47278425 missense probably damaging 1.00
R1661:Sh3pxd2a UTSW 19 47278320 missense probably damaging 1.00
R1664:Sh3pxd2a UTSW 19 47268382 missense probably benign 0.02
R1766:Sh3pxd2a UTSW 19 47273250 missense probably benign 0.01
R1931:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R1932:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R2024:Sh3pxd2a UTSW 19 47267264 missense probably benign 0.35
R2165:Sh3pxd2a UTSW 19 47278355 missense probably damaging 1.00
R2567:Sh3pxd2a UTSW 19 47424569 missense possibly damaging 0.94
R4097:Sh3pxd2a UTSW 19 47424512 missense probably damaging 1.00
R4466:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R4788:Sh3pxd2a UTSW 19 47314079 missense probably damaging 1.00
R4885:Sh3pxd2a UTSW 19 47268693 missense probably damaging 1.00
R4939:Sh3pxd2a UTSW 19 47278404 missense probably damaging 1.00
R5184:Sh3pxd2a UTSW 19 47273411 missense possibly damaging 0.90
R5340:Sh3pxd2a UTSW 19 47268231 missense probably benign 0.36
R5673:Sh3pxd2a UTSW 19 47268666 missense probably damaging 1.00
R5925:Sh3pxd2a UTSW 19 47267612 missense probably damaging 1.00
R5988:Sh3pxd2a UTSW 19 47364638 missense probably benign 0.16
R6120:Sh3pxd2a UTSW 19 47267409 missense probably damaging 0.99
R6432:Sh3pxd2a UTSW 19 47269927 missense probably damaging 0.99
R6650:Sh3pxd2a UTSW 19 47268224 missense probably benign 0.00
R6700:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R6831:Sh3pxd2a UTSW 19 47283093 missense probably damaging 1.00
V3553:Sh3pxd2a UTSW 19 47267219 missense probably benign 0.12
X0013:Sh3pxd2a UTSW 19 47267864 missense probably benign 0.01
X0026:Sh3pxd2a UTSW 19 47464150 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACACATCCTTGAGGTTGTTGTG -3'
(R):5'- GCTCAACACTGTGAACCAGAG -3'

Sequencing Primer
(F):5'- TGGATAAACTGGGACTTCTCTATG -3'
(R):5'- CCAGAGCAAGAGGGCCAC -3'
Posted On2014-10-15