Incidental Mutation 'R2211:Edem3'
ID239348
Institutional Source Beutler Lab
Gene Symbol Edem3
Ensembl Gene ENSMUSG00000043019
Gene NameER degradation enhancer, mannosidase alpha-like 3
Synonyms2310050N11Rik
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location151755371-151822051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151804702 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 526 (D526G)
Ref Sequence ENSEMBL: ENSMUSP00000058941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059498] [ENSMUST00000187951] [ENSMUST00000188145] [ENSMUST00000191070]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059498
AA Change: D526G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058941
Gene: ENSMUSG00000043019
AA Change: D526G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.5e-118 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 672 778 9.4e-16 PFAM
low complexity region 838 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187951
AA Change: D526G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140775
Gene: ENSMUSG00000043019
AA Change: D526G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 1.8e-147 PFAM
low complexity region 617 630 N/A INTRINSIC
Pfam:PA 658 762 1.6e-17 PFAM
low complexity region 820 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188145
AA Change: D526G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140443
Gene: ENSMUSG00000043019
AA Change: D526G

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.3e-144 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 676 780 4.3e-15 PFAM
low complexity region 854 871 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191070
AA Change: D526G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140234
Gene: ENSMUSG00000043019
AA Change: D526G

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3e-144 PFAM
low complexity region 616 629 N/A INTRINSIC
Pfam:PA 657 761 4.1e-15 PFAM
low complexity region 824 841 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Quality control in the endoplasmic reticulum (ER) ensures that only properly folded proteins are retained in the cell through recognition and degradation of misfolded or unassembled proteins. EDEM3 belongs to a group of proteins that accelerate degradation of misfolded glycoproteins in the ER (Hirao et al., 2006 [PubMed 16431915]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Edem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Edem3 APN 1 151818513 missense probably benign
IGL01065:Edem3 APN 1 151777551 missense probably damaging 1.00
IGL01351:Edem3 APN 1 151792385 missense possibly damaging 0.95
IGL01451:Edem3 APN 1 151818628 missense probably benign 0.21
IGL01831:Edem3 APN 1 151796082 missense probably damaging 0.97
IGL02096:Edem3 APN 1 151804719 missense probably benign 0.00
IGL02207:Edem3 APN 1 151808360 missense possibly damaging 0.77
IGL02507:Edem3 APN 1 151811656 missense probably benign 0.20
IGL02690:Edem3 APN 1 151804799 missense probably damaging 1.00
R5205_edem3_101 UTSW 1 151811519 missense probably damaging 1.00
R0421:Edem3 UTSW 1 151792438 splice site probably benign
R1463:Edem3 UTSW 1 151807510 missense possibly damaging 0.81
R1934:Edem3 UTSW 1 151804283 missense probably damaging 1.00
R1958:Edem3 UTSW 1 151804325 missense probably damaging 1.00
R2090:Edem3 UTSW 1 151804826 splice site probably benign
R2126:Edem3 UTSW 1 151794731 missense possibly damaging 0.76
R2191:Edem3 UTSW 1 151796883 missense probably damaging 1.00
R4005:Edem3 UTSW 1 151759755 missense probably damaging 1.00
R4018:Edem3 UTSW 1 151804826 splice site probably benign
R4723:Edem3 UTSW 1 151804698 missense possibly damaging 0.95
R4818:Edem3 UTSW 1 151792385 missense possibly damaging 0.95
R4871:Edem3 UTSW 1 151804231 splice site probably null
R5205:Edem3 UTSW 1 151811519 missense probably damaging 1.00
R5347:Edem3 UTSW 1 151807451 missense probably damaging 0.97
R5910:Edem3 UTSW 1 151770827 splice site probably null
R7021:Edem3 UTSW 1 151755672 missense probably benign 0.01
R7366:Edem3 UTSW 1 151812614 splice site probably null
R7481:Edem3 UTSW 1 151808222 missense probably damaging 0.98
R7481:Edem3 UTSW 1 151808223 missense possibly damaging 0.46
R7734:Edem3 UTSW 1 151818585 missense probably benign 0.00
R7773:Edem3 UTSW 1 151811596 nonsense probably null
R7828:Edem3 UTSW 1 151811635 missense possibly damaging 0.51
X0028:Edem3 UTSW 1 151818562 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACTCAGTTAATATGCTTGGTAGGAG -3'
(R):5'- ATCTCTGGTCGAAGTGAAAAGTC -3'

Sequencing Primer
(F):5'- AGGAGGGGTTACTTACAATATTGTC -3'
(R):5'- CAACTGTTGCTATAGCTCCTTAAG -3'
Posted On2014-10-15