Mutagenetix > Incidental Mutations

Incidental Mutation 'R2211:Astn1'

239349

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

040213-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R2211 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

158362273-158691781 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158657306 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 4 (R4G)

Ref Sequence

ENSEMBL: ENSMUSP00000141260 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000192821] [ENSMUST00000193042] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

probably benign
Transcript: ENSMUST00000046110
AA Change: R980G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: R980G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192821
AA Change: R4G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000141260
Gene: ENSMUSG00000026587
AA Change: R4G

Domain	Start	End	E-Value	Type
FN3	46	158	2.8e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193042
AA Change: R988G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: R988G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000194217
AA Change: R53G

Predicted Effect

probably benign
Transcript: ENSMUST00000195311
AA Change: R980G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: R980G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430078G23Rik	T	C	8: 3,387,680	S268P	possibly damaging	Het
Adam18	A	G	8: 24,628,155	S34P	probably damaging	Het
Adam23	T	A	1: 63,573,129		probably benign	Het
Adcy10	A	T	1: 165,518,212	I277F	probably damaging	Het
Arfgef3	A	T	10: 18,592,245	S1736T	possibly damaging	Het
Arhgap21	A	T	2: 20,881,640	M242K	possibly damaging	Het
AU041133	G	A	10: 82,150,921	C135Y	probably damaging	Het
Cdc42bpb	A	G	12: 111,301,854	V53A	probably benign	Het
Cdh23	T	C	10: 60,466,004	D428G	possibly damaging	Het
Cebpa	T	C	7: 35,120,466	S350P	probably damaging	Het
Cftr	A	G	6: 18,214,280	M152V	probably null	Het
Cpa4	A	G	6: 30,583,650	N255S	possibly damaging	Het
Ddx51	T	A	5: 110,655,768	D343E	probably damaging	Het
Dnah7a	T	C	1: 53,479,773	I2942V	probably benign	Het
Dnajc1	G	T	2: 18,392,475	A9E	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Edem3	A	G	1: 151,804,702	D526G	possibly damaging	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Etaa1	G	A	11: 17,952,686	Q84*	probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam149a	G	A	8: 45,341,009	T674I	probably damaging	Het
Fam98a	A	G	17: 75,538,945		probably null	Het
Fat4	A	G	3: 38,891,527	N1523S	possibly damaging	Het
Fbxw10	A	G	11: 62,867,535	T529A	probably damaging	Het
Gzf1	C	T	2: 148,684,950	A447V	probably damaging	Het
Hap1	G	A	11: 100,354,724	T138M	probably benign	Het
Hic1	T	A	11: 75,169,384	R46W	possibly damaging	Het
Id4	T	A	13: 48,261,802	L102Q	probably damaging	Het
Il3ra	T	C	14: 14,355,029	C271R	probably benign	Het
Ints4	T	C	7: 97,509,750	I443T	possibly damaging	Het
Lmln	A	G	16: 33,109,778	E535G	probably benign	Het
Lrrtm4	A	G	6: 80,022,640	H345R	probably benign	Het
Ltbp3	T	C	19: 5,753,962	I834T	possibly damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Mpp5	A	T	12: 78,797,248	K75N	possibly damaging	Het
Ms4a18	C	A	19: 10,997,305	V341L	probably benign	Het
Nbr1	T	C	11: 101,567,264		probably null	Het
Nf1	T	C	11: 79,444,064	M914T	probably benign	Het
Notch3	T	A	17: 32,147,978	H861L	probably benign	Het
Nupl1	A	G	14: 60,232,640	F341L	probably damaging	Het
Ogfod2	C	A	5: 124,112,780		probably null	Het
Oit3	T	C	10: 59,428,070	D414G	probably damaging	Het
Olfr1079	T	C	2: 86,538,513	Y132C	probably damaging	Het
Olfr1497	T	A	19: 13,795,369	M81L	probably benign	Het
Olfr787	A	T	10: 129,462,940	K88M	probably damaging	Het
Olfr804	A	G	10: 129,705,451	H191R	probably benign	Het
Pcbp4	C	A	9: 106,460,734	H74Q	probably benign	Het
Pip5k1b	A	T	19: 24,378,850	D241E	probably damaging	Het
Plcb2	T	C	2: 118,723,534	D102G	probably benign	Het
Plekha5	G	A	6: 140,525,861	E4K	possibly damaging	Het
Ppargc1a	A	C	5: 51,474,259	S343A	possibly damaging	Het
Ppwd1	G	A	13: 104,207,142	S585L	probably benign	Het
Rarg	T	C	15: 102,239,524	N284S	probably benign	Het
Rnpepl1	C	T	1: 92,916,380	L278F	probably damaging	Het
Rp1	A	C	1: 4,348,139	S917A	probably damaging	Het
Rsf1	ATGGCG	ATGGCGAGGGTGGCG	7: 97,579,904		probably benign	Het
Rsph3b	T	C	17: 6,941,740	S189G	probably benign	Het
Sec31b	A	T	19: 44,523,150	L604Q	probably damaging	Het
Sema6b	T	A	17: 56,124,741	I641F	probably benign	Het
Slc35f5	A	T	1: 125,579,264	I309F	possibly damaging	Het
Smarca4	A	G	9: 21,686,029	E1360G	probably damaging	Het
Spata31d1c	T	C	13: 65,035,939	S432P	probably benign	Het
Spsb3	T	C	17: 24,890,937		probably null	Het
Sptbn4	T	C	7: 27,367,609	D1960G	probably damaging	Het
Srgap1	A	G	10: 121,853,740	V345A	possibly damaging	Het
Tiam2	C	A	17: 3,414,918	C307*	probably null	Het
Trim43b	T	A	9: 89,085,249	T444S	possibly damaging	Het
Trmt13	A	G	3: 116,594,754	I11T	probably benign	Het
Ylpm1	A	T	12: 85,044,378	R1073*	probably null	Het
Zfp524	T	C	7: 5,017,919	S149P	probably damaging	Het
Zfp777	T	C	6: 48,043,885	I312V	possibly damaging	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158600319	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158504313	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158580327	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158668631	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158511154	intron	probably benign
IGL02168:Astn1	APN	1	158609341	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158664130	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158510950	splice site	probably benign
IGL02307:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158502408	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158505395	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158688550	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158612395	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158668623	splice site	probably benign
IGL03354:Astn1	APN	1	158688604	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158597209	missense	probably benign	0.20
PIT4366001:Astn1	UTSW	1	158597211	missense	probably benign	0.23
R0024:Astn1	UTSW	1	158684215	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158579724	splice site	probably benign
R0099:Astn1	UTSW	1	158502151	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158688548	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158509891	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158600389	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158472389	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158509890	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158511109	nonsense	probably null
R1027:Astn1	UTSW	1	158580279	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158600365	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158502353	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158579576	splice site	probably benign
R1701:Astn1	UTSW	1	158504307	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158504251	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158601945	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158505316	splice site	probably null
R1919:Astn1	UTSW	1	158509971	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158520521	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158609305	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158657120	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158600502	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158472408	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158667609	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158502150	missense	probably damaging	0.99
R2268:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158579666	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158612346	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158572951	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158667532	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158502060	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158579657	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158502032	splice site	probably null
R4625:Astn1	UTSW	1	158580294	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158502251	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158612532	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158580363	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158600380	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158601937	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158509993	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158664121	nonsense	probably null
R6481:Astn1	UTSW	1	158612462	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158511148	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158612472	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158664074	nonsense	probably null
R7062:Astn1	UTSW	1	158688511	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158572987	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158664276	splice site	probably null
R7402:Astn1	UTSW	1	158552855	intron	probably benign
R7412:Astn1	UTSW	1	158502349	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158610782	splice site	probably null
R7537:Astn1	UTSW	1	158505386	missense	possibly damaging	0.84
R7537:Astn1	UTSW	1	158667638	splice site	probably null
R7635:Astn1	UTSW	1	158667535	nonsense	probably null
R7890:Astn1	UTSW	1	158580333	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158601938	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158597316	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158688638	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158504350	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158609320	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158609280	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158502233	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158657100	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158664130	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158520500	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158668757	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158510985	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158684151	missense	probably damaging	1.00
Z1088:Astn1	UTSW	1	158472497	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158597206	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158684096	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCAGACTCTGGCACCAAG -3'
(R):5'- TTGTCCTCAACTTCAATAGTGACAC -3'

Sequencing Primer
(F):5'- GCGAATGGCAGCTGGAGTC -3'
(R):5'- CTTCAATAGTGACACCTGGATGG -3'

Posted On

2014-10-15