Incidental Mutation 'R2211:Adcy10'
ID 239350
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R2211 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 165345781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 277 (I277F)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: I277F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: I277F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: I277F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: I277F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: I277F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: I277F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148550
AA Change: I277F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: I277F

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTGGCCAAATTAGCAACCAC -3'
(R):5'- TTGATCTGGCCTCGGAAGAC -3'

Sequencing Primer
(F):5'- AATCTTCATTGACCAGTAGTGTGTG -3'
(R):5'- CCTTCAAGACAGAAGTGATGTGTAC -3'
Posted On 2014-10-15